Labshake search
Citations for Addgene :
1851 - 1900 of 2445 citations for 6H Imidazo 4 5 h quinolin 6 one 1 9 dihydro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: All shRNA plasmids were made by digesting pLKO.1 hPGK-BFP TRC cloning vector (Addgene #191566) with AgeI-HF and EcoRI-HF and annealed shRNA sequences were ligated with Quick Ligase Buffer (NEB) ...
-
bioRxiv - Neuroscience 2024Quote: ... The AAV11 capsid gene58 was synthesized and inserted into the pAAV2/1 helper vector (Addgene #112862). The following viruses were used in this study ...
-
bioRxiv - Cancer Biology 2021Quote: ... and Clover-Geminin(1-110) were a gift from Michael Lin (Addgene plasmid # 83915; http://n2t.net/addgene:83915; RRID:Addgene_83915, Addgene plasmid # 83914 ...
-
bioRxiv - Cancer Biology 2021Quote: shRNA vectors were created by annealing shRNA overlapping oligonucleotides and then cloned into pLKO.1 (Addgene, 10878). shRNA oligonucleotides sequences are detailed in Supplementary Table 1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... pLKO.1 neo was provided by Sheila Stewart (Addgene plasmid # 13425; http://n2t.net/addgene: 13425; RRID: Addgene_13425).
-
bioRxiv - Cell Biology 2020Quote: ... shRNA for LacZ (negative control) and MYC were generate according to the pLKO.1 protocol from Addgene. Cignal 45-pathway reporter arrays ...
-
bioRxiv - Neuroscience 2021Quote: ... in combination with 150nL of retrograde AAV-Cre-EBFP (Titer: 1×1013 GC/mL, Lot #V15413, Addgene) injection in PF ...
-
bioRxiv - Immunology 2020Quote: ... Table 1) were cloned into the Doxycycline (Dox)-inducible FgH1t-UTG or FgH1t-UTC construct (Addgene #70183), followed by lentiviral transduction of Cas9-expressing THP-1 and HeLa cell lines ...
-
bioRxiv - Microbiology 2019Quote: ... ADRB1 was amplified from pcDNA3 Flag beta-1-adrenergic-receptor (gift from Robert Lefkowitz; Addgene plasmid # 14698). All fragments contained ~20bp overhangs and were assembled into EcoRV cut pLenti CMV Puro DEST (w118-1 ...
-
bioRxiv - Cell Biology 2019Quote: ... AICSDP-1:PXN-EGFP was a gift from The Allen Institute for Cell Science (Addgene plasmid 87420).
-
bioRxiv - Genomics 2020Quote: Plasmid for HIV-1 reverse transcriptase expression: pCMV-dR8.2 dvpr was a gift from Bob Weinberg (Addgene plasmid # 8455 ...
-
bioRxiv - Biophysics 2021Quote: ... and transfected with either 0.1 μg pCDNA3.1-eGFP-SpRng2(1-189) or with 0.5 μg pEGFP-IQGAP1 (# 30112, Addgene) and 0.5 μg pTK93 Lifeact-mCherry ...
-
bioRxiv - Biochemistry 2020Quote: Recombinant wild-type and mutant SpCas9 (1-1,368) possessing a C-terminal decahistidine tag (Addgene, no. 62731) was expressed and purified as described previously (35) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were gel-purified and cloned into EcoRV-cut pLenti CMV Puro DEST (w118-1) (Addgene #17452 ...
-
bioRxiv - Cancer Biology 2020Quote: Plasmid 821 pGEX2T PTEN 1-274 (N-PTEN) was a gift from William Sellers (Addgene plasmid # 10741) (Ramaswamy et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... pLL3.7m-Clover-Geminin(1-110)-IRES-mKO2-Cdt(30-120) was a gift from Michael Lin (Addgene plasmid # 83841 ...
-
bioRxiv - Neuroscience 2022Quote: GAD2-IRES-Cre mice were injected with AAV2/1-pEF1a-DIO-FLPo-WPRE-hGHpA (Addgene #87306-AAV1) in ZI ...
-
bioRxiv - Neuroscience 2022Quote: ... GAD2-IRES-Cre mice were injected with AAV2/1-pEF1a-DIO-FLPo-WPRE-hGHpA (Addgene #87306-AAV1) in ZI ...
-
bioRxiv - Neuroscience 2021Quote: ... the successful clone was transduced with lentivirus using pLenti CMV V5-LUC Blast (Addgene, cat# w567-1), followed by blasticidin selection ...
-
bioRxiv - Molecular Biology 2020Quote: ... For generation of the RPE-1-H2B-mEGFP-FKBP stable cell line the H2B-mEGFP (Addgene #105528) and FKBP (Promega N201A ...
-
bioRxiv - Neuroscience 2021Quote: ... under the control of the human synapsin-1 gene promoter (AAV-GFP/Cre, 105540-AAV1, pENN.AAV1.hSyn.HI.eGFP-Cre.WPRE.SV40, Addgene, Massachusetts, USA) or with AAV expressing only GFP (AAV-GFP ...
-
bioRxiv - Physiology 2022Quote: ... or scramble short hairpin RNA (shRNA) (Table 3) was inserted into the plasmid pLKO.1 (8453; Addgene). pSF-lenti or pLKO.1 together with the two helper plasmids psPAX2 (Addgene plasmid 12260 ...
-
bioRxiv - Biochemistry 2021Quote: NF1 (isoform 1) was subcloned from R777-E139 Hs.NF1 (a gift from Dominic Esposito, Addgene plasmid #70423) as an N-terminal His6-tagged protein in pFastBac1 (Invitro-gen) ...
-
bioRxiv - Cell Biology 2020Quote: Specific shRNA1 and shRNA2 targeting human ARID1A were cloned into the pLKO.1-TRC-puro vector (Addgene), separately ...
-
bioRxiv - Developmental Biology 2020Quote: 1 kb homology arms were generated through PCR and cloned into the pHD-dsRed-attP (Addgene #51019). Guide RNAs and the donor vector were co-injected into vas-Cas9 embryos (BDSC #51324 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The GFP1-10 and GFP11×7 fragments were obtained from plasmids pcDNA3.1-GFP(1-10) (Addgene: 70219) and pACUH-GFP11×7-mCherry-α-tubulin (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmid BK Dunlop and JC Mad-1 were gifts from Peter Howley (Addgene plasmids # 25466 and #25626) and were used as positive controls for 1:1 VP1/Large T-antigen copy number ...
-
bioRxiv - Genetics 2020Quote: The plasmid that contains the isoform 1 of human DNMT3B (DNMT3B1) was purchased from Addgene (cat # 35522). The DNMT3B1 cDNA was then fused to an N-terminal Flag tag by PCR ...
-
bioRxiv - Microbiology 2022Quote: ... pCMV encoding HIV-1 Vpr fused to beta lactamase (pCMV4-BlaM-Vpr) was obtained from Addgene (21950). A plasmid encoding replication-incompetent HIV-1 lacking env and vpr and encoding luciferase (pNL4-3LucR-E- ...
-
bioRxiv - Cancer Biology 2022Quote: ... The oligos were annealed and cloned into the pLKO.1 hygro vector from Addgene (plasmid no. 24150).
-
bioRxiv - Genetics 2022Quote: ... 1 kb homology arms were generated through PCR and cloned into the pHD-dsRed-attP (Addgene #51019) [73] ...
-
bioRxiv - Microbiology 2023Quote: ... the puromycin N-acetyltransferase (PAC) gene was amplified from pLenti CMV Puro DEST (w118-1) (Addgene #17452) by PCR ...
-
bioRxiv - Cell Biology 2022Quote: ... Small hairpin RNAs (shRNA) targeting sequences for specific genes were cloned in pLKO.1-Puro vector (Addgene). Upon production by 293T cells ...
-
bioRxiv - Neuroscience 2024Quote: ... GABAergic interneuron targeting was achieved with 0.45 µl of AAV1-1/2mDlx-HBB-hChR2-mcherry (Addgene 83898) (viral titer 7×1012 vg per ml ...
-
bioRxiv - Neuroscience 2024Quote: ... stereotactic injection of EnVA-CVS-N2c-dG-H2B-tdTomato (70 nL; dilution 1/10, Addgene plasmid: #175441)19 was performed at P30 in animals previously injected with AAV-3xgRNA-DIO-TVA-N2cG at P0 (80 nl) ...
-
bioRxiv - Developmental Biology 2024Quote: ... The HDR plasmid containing ippk-1 homology arms and the GFP and selection cassette (pDD282, Addgene #66823) was made using Gibson Assembly as described in Dickinson et al ...
-
bioRxiv - Immunology 2022Quote: ... gene specific target sequences (available upon request) were cloned into the lentiviral vector pLKO.1-puro (Addgene) as described in (Tsopoulidis ...
-
bioRxiv - Microbiology 2023Quote: ... was combined with 1 ug lenti CRISPR V2 plasmid (a gift from Feng Zhang, Addgene plasmid #52961) expressing the guide RNA (gRNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... was generated by Gibson assembly of the following fragments: the EF-1 alpha promoter (from Addgene #2261), the Kozak-3XFLAG fragment (from c3GIC9 ...
-
bioRxiv - Microbiology 2023Quote: ... An inducible GFP was made by inserting the Yersinia operon 1 promoter sequence into plasmid pFCcGi (Addgene) upon restriction with HindIII and XbaI (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLenti CMV GFP Blast (659–1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17445). pHAGE-PIK3CA-H1047L was a gift from Gordon Mills & Kenneth Scott (Addgene plasmid # 116499 ...
-
bioRxiv - Cancer Biology 2023Quote: ... High complexity barcoding library LARRY Barcode Version 1 library79 was a gift from Fernando Camargo (Addgene #140024). Retroviral stocks were generated using pCL-Eco plasmid ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sequences (shPROX1-1: TGCTGTTGACAGTGAGCGCGAGGACCAAGATGTCATCTCATAGTGAAGCCACAGATGTATGAGATGAC ATCTTGGTCCTCATGCCTACTGCCTCGGA; shPROX1-2: TGCTGTTGACAGTGAGCGCCCCCGAGAAAGTTAC AGAGAATAGTGAAGCCACAGATGTATTCTCTGTAACTTTCTCGGGGATGCCTACTGCCTCGGA) were cloned into the LT3GEPIR backbone100 (Addgene; 111177) and used to generate lentiviral particles to transduce into organoids as described99 ...
-
bioRxiv - Neuroscience 2023Quote: ... to induce expression of Voltron2-ST and a 1:150 dilution of AAV9-hSyn-Cheriff-EGFP (Addgene plasmid #51697 ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLenti-CMV-GFP-Blast (659-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17445). pRL-SV40P was a gift from Ron Prywes (Addgene plasmid # 27163) ...
-
bioRxiv - Cancer Biology 2023Quote: ... A CRISPR/dCas9 vector was constructed as follows: pX330A_dCas9-1×2 (Addgene, Watertown, MA; plasmid ID 63596) (20 ...
-
bioRxiv - Plant Biology 2023Quote: ... fw2.2-sgRNA-1 and fw2.2-sgRNA-2 were fused to the Arabidopsis AtU6-26 promoter (Addgene #46968) by digestion-ligation reaction in plCH47751 (Addgene #48002 ...
-
bioRxiv - Developmental Biology 2023Quote: ... CRISPR guide RNAs (gRNAs) targeting exon 1 of SLC25A1 were subcloned into lentiCRISPR v2 (Addgene Plasma 52961) using BbsI sites as described.33,40 Non-targeting guides were generated using previously reported sequences.
-
bioRxiv - Genomics 2022Quote: ... The open reading frames of H3 and H4 were cloned in the Dox-inducible expression vector KA0717 (KA0717_pPB-hCMV*1-cHA-IRESVenus was a gift from Hans Schöler, Addgene plasmid #124168; http://n2t.net/addgene:124168; RRID:Addgene_124168) fused at their 3’ end in frame to the sequence of the yellow fluorescent protein (YFP ...
-
bioRxiv - Developmental Biology 2023Quote: ... nls::Cas9::nls (subcloned from Eef1a-1955/- 1>nls::Cas9::nls a gift from Lionel Christiaen, Addgene plasmid # 59987 ;http://n2t.net/addgene:59987 ...