Labshake search
Citations for Addgene :
1851 - 1900 of 4199 citations for 6H Dibenzo a g quinolizinium 5 8 13 13a tetrahydro 2 9 dihydroxy 3 10 dimethoxy 7 methyl 7S 13aS since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... each sublibrary pool was co-transfected with third-generation lentiviral packaging plasmids (pVSV-G/MD2.G [Addgene, 12259], pRSV-Rev [Addgene, 12253] and pMDLg [Addgene, 12251]) into low-passage HEK293T cells ...
-
bioRxiv - Neuroscience 2021Quote: ... were performed over a 5 min period with 1 µL of AAV9-hSyn-Cre (Titer ≥ 1×10¹³ vg/mL, Addgene, Cat. No. 105553-AAV9) or un-injected ...
-
bioRxiv - Biochemistry 2022Quote: ... The wild-type 14-3-3 ζ gene was cloned into NcoI/XhoI digested pBAD plasmid (Addgene #85482) with a TEV cleavable C-terminal His6 purification tag ...
-
bioRxiv - Neuroscience 2023Quote: ... neonatal Swiss Webster or C57Bl/6 (P0–3) mice were anesthetized on ice for 3 min before injecting viral vectors (AAV5.GfaABC1D.GCaMP6f.SV40 [Addgene, 52925-AAV5] ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene #104964), pAAV2/6 (Addgene #110660) ...
-
bioRxiv - Genomics 2020Quote: ... pCFJ104 - Pmyo-3∷mCherry∷unc-54 (Addgene plasmid # 19328 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 3 μg psPAX2 (packaging plasmid; Addgene) was performed using iN-fect (Intron Biotechnology ...
-
bioRxiv - Cell Biology 2021Quote: ... and pGH8 (Prab-3::mCherry, Addgene #19359) (Frøkjaer-Jensen et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 μg of pGW-PervevalHR (Addgene #57432) (22) ...
-
bioRxiv - Immunology 2021Quote: ... myc (pCSF107mT-GATEWAY-3’-Myc tag, Addgene), green fluorescence protein (GFP ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 3 μg of pVSVg (8454; Addgene); FuGENE HD transfection reagent (Promega ...
-
bioRxiv - Genetics 2022Quote: ... Tc’hsp5’-Gal4Delta-3’UTR] (Addgene plasmid # 86449) was used as a donor plasmid with Piggybac insertion repeats and the 3xP3::EGFP reporter (Schinko et al. ...
-
bioRxiv - Physiology 2023Quote: ... and mPlum-mito-3 (Addgene plasmid #55988) using Fugene6 (Promega Inc. ...
-
bioRxiv - Neuroscience 2022Quote: ... +0.4 ML with diluted (1:3; Addgene) 4 × 0.15 μL of AAV9-Synapsin-jGCaMP7f-WPRE (Addgene) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... MAFA in pX330S-3 (Plasmid #58779, Addgene), Insulin in pX330S-4 (Plasmid #58780 ...
-
bioRxiv - Genomics 2023Quote: ... with 3 μg of psPAX (Addgene, 12260) and 1 μg of pMD2.G (Addgene ...
-
bioRxiv - Immunology 2024Quote: ... pcDNA-HA-14-3-3β (Addgene #13270), pcDNA-HA-14-3-3σ (Addgene #11946 ...
-
bioRxiv - Immunology 2024Quote: ... pCS2-HA-14-3-3ε (Addgene #116886), pCS2-HA-14-3-3ζ (Addgene #116888 ...
-
bioRxiv - Immunology 2024Quote: ... pcDNA-HA-14-3-3σ (Addgene #11946) and pGEX-4T2-14-3-3 tau (θ ...
-
bioRxiv - Immunology 2024Quote: ... pCS2-HA-14-3-3ζ (Addgene #116888) and pCS2-HA-14-3-3η (Addgene #116887 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The N-Terminal pFLAG 3 vector (Addgene) was employed for cloning the DCLK1 DCX DNA by restriction digest ...
-
bioRxiv - Cancer Biology 2021Quote: ... For generation of KO cell line pools PC-9 and HCC827 cells were transduced with pKLV2-EF1a-Cas9Bsd-W (Addgene ID:68343)[71] to stably express Cas9 ...
-
bioRxiv - Cell Biology 2021Quote: ... this cell line was co-transfected with a 9:1 ratio of pCENP-B-Cherry (a gift from Michael Lampson; Addgene plasmid #45219) and pPGKpuro resistance plasmid ...
-
bioRxiv - Cell Biology 2020Quote: ... SKO cells were transfected with pSH-EFIRES-P-GFP(1-10)opti AAVS1 Safe Harbor integration plasmid (Addgene plasmid # 129416, [35] and pCas9-sgAAVS1-2 (Addgene plasmid # 129727 [47]), and a stable pool was selected using puromycin (1 µg/ml puromycin for 6 days ...
-
bioRxiv - Molecular Biology 2023Quote: Constructs for shRNA targeting Primpol (5’- ATTTAGCCGACACCTAATATT) Smarcal1 (5’- CTGATTCAAGAGAAGATTAAA) and Smug1 (5’- AACTATGTGACTCGCTACT) were designed and inserted into pLKO.1neo plasmid (Addgene #13425). Lentiviruses were generated using a standard protocol (Feng and Jasin ...
-
bioRxiv - Bioengineering 2022Quote: ... with 2 μg MLC-2 plasmid (pEGFP-MRLC1, Addgene, #35680), 10 μg RAR-β siRNA (Santa Cruz ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... were generated using three plasmids to ensure a single round of infectivity: a pseudotyping plasmid for transient expression of the VSV-G envelope protein (pMD2.G, Addgene plasmid #12259, gift from Didier Trono), a plasmid for transient expression of the viral gag/pol ...
-
Axon-secreted chemokine-like Orion is a signal for astrocyte infiltration during neuronal remodelingbioRxiv - Neuroscience 2020Quote: ... to recombine the inserts into the destination UAS vector pJFRC81-GW-2xMyc (L. G. F., unpublished) which was generated from pJFRC81-10XUAS-IVS-Syn21-GFP-p10 (Addgene plasmid 36462 deposited by G. Rubin43) by replacing the GFP ORF with a Gateway cassette adding on a C-terminal 2x Myc tag ...
-
bioRxiv - Neuroscience 2023Quote: ... The 5-HT1eR and 5-HT1FR PRESTO-Tango constructs were obtained from Addgene. For transfection ...
-
bioRxiv - Molecular Biology 2020Quote: pMD2.G (Addgene plasmid # 12259; http://n2t.net/addgene:12259; RRID: Addgene_12259) and pCMVR8.74 (Addgene plasmid # 22036 ...
-
bioRxiv - Cell Biology 2020Quote: ... mCh-Rab7A and mCh-Rab5 (RRID:Addgene_61804, RRID:Addgene_49201, gift from G. Voeltz30,31), pLV-CMV-LoxP-DsRed-LoxP-eGFP and pcDNA3.1-CMV-CFP;UBC-Cre25nt (RRID:Addgene_65726 ...
-
bioRxiv - Biophysics 2022Quote: ... G (a gift from Didier Trono, Addgene plasmid #12260 and #12259). Jurkat cells were transduced by spinoculation of virus using polybrene ...
-
bioRxiv - Cell Biology 2022Quote: ... These plasmids were cotransfected with psPAX2 and pMD2.G (Addgene, #12259) into HEK-293T cells at ∼80% confluency using LipoD293 (SignaGen ...
-
bioRxiv - Molecular Biology 2019Quote: ... Lentivirus was produced by co-transfecting with pMD2.G (12259, Addgene) and psPAX2 (12260 ...
-
bioRxiv - Immunology 2019Quote: ... (78) using virulence and packaging vectors (pMD2.G (Addgene no. #12259) and psPAX2 (Addgene no ...
-
bioRxiv - Neuroscience 2020Quote: ... and the VSVG envelope glycoprotein vector pMD2-G (Addgene plasmid #12259) into HEK293T cells ...
-
bioRxiv - Biochemistry 2021Quote: ... and pMD2.G (a gift from Didier Trono Addgene plasmid # 12259) in the presence of 1□μg/μL of polyethylenimine (PEI ...
-
bioRxiv - Cancer Biology 2021Quote: HEK293FT cells were co-transfected with pCMV-VSV-G (Addgene #8454), psPAX2 (Addgene #12260 ...
-
bioRxiv - Cancer Biology 2021Quote: ... was packaged in HEK293T cells using the pMD2.G (Addgene 12259) and psPAX2 (Addgene 12260 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 2nd generation retroviral (pUMVC3-gag-pol, pMD2.G-VSVG, Addgene) helper plasmids were also amplified using the same kit ...
-
bioRxiv - Developmental Biology 2021Quote: ... along with 0.2 μg each of pCMV-VSV-G (Addgene, 8454), pRSV-Rev (Addgene ...
-
bioRxiv - Neuroscience 2020Quote: ... and the pCMV-VSV-G envelope plasmid (Addgene 12260 and 8454) with Fugene HD (Promega ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pCMV-VSV-G/pCMV-dR8.2 for human cell lines (Addgene plasmid #8454 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and either 340 ng of pCEF-VSV-G (Addgene plasmid # 41792) or 680ng of 2.2 (Addgene plasmid # 34885 ...
-
bioRxiv - Bioengineering 2022Quote: ... a stimulatory G-protein coupled receptor (custom made Chemogenetics AAV: Addgene). Clozapine-N-oxide (CNO ...
-
bioRxiv - Bioengineering 2022Quote: ... with second-generation lentiviral vectors pMD2.G (12259, Addgene, MA, USA) and psPax2 (12260 ...
-
bioRxiv - Cell Biology 2022Quote: ... and pMD2.G (Addgene plasmid # 12259; http://n2t.net/addgene:12259; RRID:Addgene_12259) were a gift from Didier Trono ...
-
bioRxiv - Microbiology 2021Quote: ... psPAX2 and pMD2.G were a gift from Didier Trono (Addgene plasmid # 12260 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Lentiviral packaging plasmids pMD2.G (a gift from Didier Trono, Addgene plasmid #12259 ...
-
bioRxiv - Developmental Biology 2019Quote: ... they were cotransfected with 3.5 μg of pMD2.G (Addgene 12259), 6.5 μg of psPAX2 (Addgene 12260 ...