Labshake search
Citations for Addgene :
1801 - 1850 of 2428 citations for 7 Benzyloxy 10 11 dihydrodibenzo b f 1 4 thiazepin 11 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... 2012) were cloned into the pLKO.1-Puro vector (a gift from R. Weinberg; Addgene #8453) to generate pLKO.1-Cys-TD and pLKO.1-Scr-TD ...
-
bioRxiv - Immunology 2021Quote: ... Guide 1 (TGTTGGGGAACATATGACAC) and Guide 2 (AAGGAAAAATTCAAACAAGG) sequences were cloned into lentiGuide-puro plasmid (Addgene, #52963), transformed in Stbl3 bacteria (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... Major changes to the reported protocol included: 1) Use of a 2nd generation psPAX2 (Addgene, #12260) lentivirus packaging system instead of the 3rd generation system used by the Bloom lab ...
-
bioRxiv - Neuroscience 2022Quote: ... mice were infused with diluted (1:5) or undiluted virus pAAV5-CAMKIIa-(hChR2- H134R)-eYFP (Addgene-ChR2 titre ...
-
bioRxiv - Cell Biology 2022Quote: ... The GFP-RIAM(1-666) construct was a gift from Chinten James Lim (Addgene plasmid 80028) (Lee et al. ...
-
bioRxiv - Genetics 2022Quote: ... Transfection mix for each shRNA contained 8.75μg of shRNA targeting construct in pLKO.1 (Addgene#8453), 8.75μg psPAX2 (Addgene#12260 ...
-
bioRxiv - Neuroscience 2022Quote: ... adeno-associated virus AAV8 carrying CaMKII-GCaMP6f (pENN.AAV.CamKII.GCaMP6f.WPRE.SV40. Addgene. #100834. 1×1012 genome copies per ml) was injected with Nanoject-III (Drummond Scientific Company ...
-
bioRxiv - Molecular Biology 2022Quote: ... was used per manufacturer’s instruction to add 1 µg of the mRFP-UtrCH plasmid (Addgene #26739) to both WT and PDKO T-REx-293 cells seeded in 6-well plates at ∼70% confluency ...
-
bioRxiv - Cancer Biology 2022Quote: ... Annealed gRNA oligos were ligated to pLKO.1-puro U6 sgRNA BfuAI stuffer (Addgene plasmid #50920), and lentiviral particles were generated ...
-
bioRxiv - Developmental Biology 2023Quote: Lentiviral shRNA expression constructs were generated by first modifying the pLKO.1 puro vector (Addgene #8453), digesting with BamHI and KpnI and replacing the puromycin resistance cassette with an mCherry coding sequence.
-
bioRxiv - Neuroscience 2024Quote: ... 2 µL of the adeno-associated viral vector rAAV9/1.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, #20298-AAV9) was dyed with 0.3 µL fast green (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... 600 nL (in AuCx) or 1 µL (in IC) of AAV1-hSyn-hChR2(H134R)-EYFP (Addgene, Item# 26973-AAV1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... as well as overhangs for assembly into the STARR-seq vector (Addgene #99296; Supplemental Table 1) according to the manufacturer’s instruction (10 to 11 cycles of amplification) ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice were injected with ∼2000 nl of a 1:6 ratio of AAV1-Syn-Cre (AAV.hSyn.Cre.WPRE.hGH, 105553-AAV1, Addgene) and AAV1-CAG-tdTomato (59462-AAV1 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV1-hSyn-GCaMP7b (2 × 1013 vg/mL Penn Vector Core/Addgene; diluted 1:2 in saline) for imaging of pulvinar axons ...
-
bioRxiv - Genetics 2023Quote: ... and the annealed sense and antisense shRNA oligonucleotides were cloned into pLKO.1-puro vector (Addgene) for knockdown of human KISS1 ...
-
bioRxiv - Developmental Biology 2023Quote: H2B-EGFP mRNA was transcribed from plasmid #1 pCS-H2B-EGFP (Megason, 2009) (Addgene, Plasmid #53744). To construct pCS2-myrTagRFP-T (plasmid #2) ...
-
bioRxiv - Genetics 2023Quote: pHarvester was generated using pCFD5-gRNA#1&2 and pnos-Cas9-nos plasmids (Addgene no: 62208). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: ... Both pie-1p and pie-1 3’UTR PCR products were amplified using pPK605 plasmid (Addgene) as the template.
-
bioRxiv - Cancer Biology 2023Quote: SNAIL and SLUG knockout PANC-1 cell lines were generated using lentiCas9-Blast (Addgene plasmid 52962) and lentiGuide-Puro (Addgene plasmid 52963 ...
-
bioRxiv - Neuroscience 2023Quote: ... Addgene #55639 (packaged in AAV2/1) AAV2/8-EF1a-fDIO-ChrimsonR-mRuby2-KV2.1TS modified from Addgene #124603 pAAV-hSyn1-SIO-stGtACR2-FusionRed ...
-
bioRxiv - Biochemistry 2023Quote: ... Mouse H2A.Z.1 gene in pIND-EGFP was a kind gift from from Danny Rangasamy (Addgene plasmid # 15770 ...
-
bioRxiv - Neuroscience 2023Quote: Heterozygous ChAT-Cre mice were bilaterally injected with 1.0 µL of pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (diluted 1:2 in dPBS; Addgene: 100845-AAV5) in basal forebrain (AP ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Human FUS (residues 1-214) was amplified by PCR using pHR-FUSN-mCh-Cry2WT (Addgene #101223). The IDRs fragments were fused with TPPPCORE domain(aa.45-166 ...
-
bioRxiv - Neuroscience 2023Quote: ... pcDNA3.1 Dynamin 1 (human, p880) was a gift from Sandra Schmid and was obtained from Addgene (Addgene plasmid #34682 ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO.1 and pLKO.5 were sourced from Addgene (#1864; a gift from David Sabatini 9) and Sigma-Aldrich (St ...
-
bioRxiv - Microbiology 2024Quote: GECs were transfected with 1 µg of pFLAG-CMV2-Hsp27-S78D/S82D (Addgene plasmid # 85187 [69]), a constitutively activated HSp27 construct ...
-
bioRxiv - Neuroscience 2024Quote: ... All shRNA plasmids were made by digesting pLKO.1 hPGK-BFP TRC cloning vector (Addgene #191566) with AgeI-HF and EcoRI-HF and ligating annealed shRNA sequences with Quick Ligase Buffer (NEB ...
-
bioRxiv - Neuroscience 2024Quote: Primary rat hippocampal neurons at DIV3 were infected with pLKO.1-TRC mTagBFP2 (Addgene, plasmid #191566) to express JPH3 shRNA (from OrigGene ...
-
bioRxiv - Cancer Biology 2024Quote: The shRNA sequences were inserted into the pLKO.TRC.1 plasmid (Addgene, Cat#10878, RRID: Addgene_10878, Addgene).
-
bioRxiv - Cancer Biology 2024Quote: The shRNA sequences were inserted into the pLKO.TRC.1 plasmid (Addgene, Cat#10878, RRID: Addgene_10878, Addgene).
-
bioRxiv - Neuroscience 2024Quote: All shRNA plasmids were made by digesting pLKO.1 hPGK-BFP TRC cloning vector (Addgene #191566) with AgeI-HF and EcoRI-HF and annealed shRNA sequences were ligated with Quick Ligase Buffer (NEB) ...
-
bioRxiv - Neuroscience 2024Quote: ... The AAV11 capsid gene58 was synthesized and inserted into the pAAV2/1 helper vector (Addgene #112862). The following viruses were used in this study ...
-
bioRxiv - Cancer Biology 2021Quote: ... and Clover-Geminin(1-110) were a gift from Michael Lin (Addgene plasmid # 83915; http://n2t.net/addgene:83915; RRID:Addgene_83915, Addgene plasmid # 83914 ...
-
bioRxiv - Cancer Biology 2021Quote: shRNA vectors were created by annealing shRNA overlapping oligonucleotides and then cloned into pLKO.1 (Addgene, 10878). shRNA oligonucleotides sequences are detailed in Supplementary Table 1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... pLKO.1 neo was provided by Sheila Stewart (Addgene plasmid # 13425; http://n2t.net/addgene: 13425; RRID: Addgene_13425).
-
bioRxiv - Cell Biology 2020Quote: ... shRNA for LacZ (negative control) and MYC were generate according to the pLKO.1 protocol from Addgene. Cignal 45-pathway reporter arrays ...
-
bioRxiv - Neuroscience 2021Quote: ... in combination with 150nL of retrograde AAV-Cre-EBFP (Titer: 1×1013 GC/mL, Lot #V15413, Addgene) injection in PF ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 μl of AAV2/5-GfaABC1D-Lck-GCaMP6f (1013 genome copies/ml) (Addgene viral prep # 52924-AAV5) was injected into the DLS ...
-
bioRxiv - Immunology 2020Quote: ... Table 1) were cloned into the Doxycycline (Dox)-inducible FgH1t-UTG or FgH1t-UTC construct (Addgene #70183), followed by lentiviral transduction of Cas9-expressing THP-1 and HeLa cell lines ...
-
bioRxiv - Microbiology 2019Quote: ... ADRB1 was amplified from pcDNA3 Flag beta-1-adrenergic-receptor (gift from Robert Lefkowitz; Addgene plasmid # 14698). All fragments contained ~20bp overhangs and were assembled into EcoRV cut pLenti CMV Puro DEST (w118-1 ...
-
bioRxiv - Cell Biology 2019Quote: ... AICSDP-1:PXN-EGFP was a gift from The Allen Institute for Cell Science (Addgene plasmid 87420).
-
bioRxiv - Genomics 2020Quote: Plasmid for HIV-1 reverse transcriptase expression: pCMV-dR8.2 dvpr was a gift from Bob Weinberg (Addgene plasmid # 8455 ...
-
bioRxiv - Biophysics 2021Quote: ... and transfected with either 0.1 μg pCDNA3.1-eGFP-SpRng2(1-189) or with 0.5 μg pEGFP-IQGAP1 (# 30112, Addgene) and 0.5 μg pTK93 Lifeact-mCherry ...
-
bioRxiv - Biochemistry 2020Quote: Recombinant wild-type and mutant SpCas9 (1-1,368) possessing a C-terminal decahistidine tag (Addgene, no. 62731) was expressed and purified as described previously (35) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were gel-purified and cloned into EcoRV-cut pLenti CMV Puro DEST (w118-1) (Addgene #17452 ...
-
bioRxiv - Cancer Biology 2020Quote: Plasmid 821 pGEX2T PTEN 1-274 (N-PTEN) was a gift from William Sellers (Addgene plasmid # 10741) (Ramaswamy et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... pLL3.7m-Clover-Geminin(1-110)-IRES-mKO2-Cdt(30-120) was a gift from Michael Lin (Addgene plasmid # 83841 ...
-
bioRxiv - Neuroscience 2022Quote: GAD2-IRES-Cre mice were injected with AAV2/1-pEF1a-DIO-FLPo-WPRE-hGHpA (Addgene #87306-AAV1) in ZI ...
-
bioRxiv - Neuroscience 2022Quote: ... GAD2-IRES-Cre mice were injected with AAV2/1-pEF1a-DIO-FLPo-WPRE-hGHpA (Addgene #87306-AAV1) in ZI ...