Labshake search
Citations for Addgene :
1801 - 1850 of 2137 citations for 6 METHYL 2H PYRIDO 1 2 A PYRIMIDIN 2 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... Jürg Müller (for generation of pcDNA5.1-FRT/TO-puro-(N)GFP-TEV-FLAG-3C-BAP1) or originated from Wade Harper’s laboratory obtained from Addgene (for generation of pcDNA5-FRT/TO-puro-eGFP-BAP1) ...
-
bioRxiv - Developmental Biology 2022Quote: Nek2 sgRNAs (Supplementary Table 1) were cloned into the CRISPR-Cas9 plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid 62988 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pT-mAppleT2Apuro(15.1kb) was generated by cloning a PacI/BamHI restriction enzyme fragment from pAdEasy-1 (Addgene, Plasmid#16400) into pT-mApple ...
-
bioRxiv - Neuroscience 2022Quote: ... Adeno-associated virus for expressing jGCaMP6f or jGCaMP7f under the synapsin-1 promoter (AAV1-syn-jjGCaMP6f-WPRE-SV40, Addgene, 100837 ...
-
bioRxiv - Plant Biology 2022Quote: ... The LacZ selection marker was PCR amplified with flanking BsaI sites into Level 1 acceptor vector pICH41780 (Addgene #48019) to allow blue-white screening for successful gRNA insertion into final ABE vectors ...
-
bioRxiv - Neuroscience 2022Quote: ... we used stereotactically targeted virus injections of rAAV S1 FLEX-CAG-jGCaMP7s-WPRE (Lot v28549, Addgene, #104495 AAV-1) into the MSDB of 3— 6 months old ChAT-Cre mice ...
-
bioRxiv - Neuroscience 2022Quote: ... or rAAV2/9 encoding for NIR-GECO2 under control of the synthetic CAG promoter (0.5 × 1012 -1 × 1013 gc/ml; AddGene plasmid #159603 ...
-
bioRxiv - Neuroscience 2022Quote: ... A retrograde GFP-tagged adeno-associated virus rAAV2/1-retro (retrograde AAV-CAG-GFP; serotype “retro”, Addgene, Cat. # 37825) was pressure injected into M2 (170 ...
-
bioRxiv - Genomics 2023Quote: ... Both gRNA (1 µg each) vectors were co-transfected with 3 µg of pCas9_GFP (a gift from Kiran Musunuru; Addgene plasmid #44719 ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLenti CMV Puro LUC (w168-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17477; http://n2t.net/addgene:17477; RRID: Addgene_17477). For human BTIC injection into athymic nude mice ...
-
bioRxiv - Neuroscience 2023Quote: ... 1.3×1012 vg/mL) was mixed with AAV1-CAG-FLEX-EGFP-WPRE (Addgene; Cat # 51502; ≥ 1×1013 vg/mL) in a 4:1 ratio ...
-
bioRxiv - Genomics 2023Quote: ... We replaced the hU6-sgRNA cassette with the mU6-sgRNA cassette from pMK1334 (ref. 1) (Addgene plasmid #127965, RRID:Addgene_127965) by restriction cloning between sites MluI and XbaI ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA sequences were cloned into the 3rd generation transfer plasmid pLKO.1 TRC cloning vector (Addgene cat no. 10878) between unique AgeI and EcoRI sites downstream of the U6 promoter ...
-
bioRxiv - Neuroscience 2023Quote: ... a mixture of flexed AAV GFP (pAAV-FLEX-GFP-Virus, titer ≥ 1×10¹³ vg/mL, Addgene 28304-AAV PHPeB) and CamKII-Cre (pENN.AAV.CamKII 0.4.Cre.SV40 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/1.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (titer: 2.6·1013; a gift from Douglas Kim & GENIE Project, Addgene viral prep #100854-AAV1) was pressure-injected using a glass micropipette at ∼400 μm depth (200–250 nl per injection) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the sgRNA (see table 1) was cloned in to pX458 (Addgene plasmid no 48138(Ran, Hsu et al. 2013)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Single guide-RNA plasmids were generated by cloning oligonucleotides to the target site (see table 1) into pX335 (Addgene plasmid no ...
-
bioRxiv - Cancer Biology 2023Quote: ... and WDR6 (N-6xHis) coding sequences were codon-optimized for e.coli bacteria and cloned separately into petDuet-1 (purchased from Addgene) using the NcoI site downstream of the first T7 promoter ...
-
bioRxiv - Synthetic Biology 2023Quote: ... All plasmids that express GFPuv under the control of a phoB promoter were obtained from Addgene (supplemental table 1) 43,46 ...
-
bioRxiv - Neuroscience 2023Quote: We designed the syt-jGCaMP8s construct by linking the Drosophila synaptotagmin-1 coding sequences and jGCaMP8s (Addgene Plasmid #162380)69 using a GSGSGS linker ...
-
bioRxiv - Genomics 2023Quote: To create dual-enSERT-1 constructs, we used PCR4-Hsp68::lacZ-H11 plasmid (Kvon et al., 2020) (Addgene #139099) and replaced lacZ with eGFP or mCherry fluorescent reporters using Gibson cloning (Gibson et al. ...
-
bioRxiv - Biophysics 2023Quote: ... pLenti CMV rtTA3 Hygro (w785-1) was a gift from Eric Campeau (Addgene plasmid #26730; http://n2t.net/addgene:26730; RRID: Addgene_26730). pLenti CMV rtTA3 Hygro is called rtTA3 in the next sections.
-
bioRxiv - Immunology 2023Quote: ... a 4-1BB costimulatory domain and the CAR construct utilized for animals R.301-304 additionally expressed EGFRt.23 CARs were encoded by an xHIV plasmid which was co-transfected with an HIV-1 Rev/Tat and VSV-G envelope plasmid (RRID:Addgene_138479) for lentiviral production as previously described.23
-
bioRxiv - Neuroscience 2024Quote: The shRNA construct for mouse aldolase A was generated using oligos directed towards the 3’UTR of Aldoa (GCCCACTGCCAATAAACAACT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) and cloned into the pLKO.1 cloning vector (Addgene Cat# 10878, RRID:Addgene_10878) and pCGLH vector for lentivirus and in utero electroporation experiments ...
-
bioRxiv - Cancer Biology 2023Quote: ... A 10-μl Hamilton syringe was used to infuse 1 μl of AAV1/Syn-GCaMP6f-WPRESV40 (titer 4.65 × 1013 GC per ml, via Addgene) into the parabrachial nucleus (−5.3 mm anteroposterior ...
-
bioRxiv - Neuroscience 2024Quote: ... a total volume of 10-20 ul of AAVrg-FLEX-taCasp3-TEVp (titer >1 × 1012 pfu/ml; Addgene 45580) was injected into the medial and left lobes of the livers of AvilCreERT2 mice ...
-
bioRxiv - Neuroscience 2024Quote: ... A genetically encoded calcium indicator for the detection of ACh activity (1 μL, AAV9-hSyn-ACh3.0; AddGene; Watertown, MA) was infused into the medial prefrontal cortex (AP(2.7mm) ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV injections consisted of a 1:10 cocktail of Cre [AAV5-CMV-HI-eGFP-Cre.WPRE.SV40 (Addgene plasmid no. 105545) packaged at UPenn Vector Core 2.5 × 1014 GC ml−1] and KORD [AAV8-HSyn-DIO-HA-KORD-IRES-mCitrine (Addgene plasmid no ...
-
bioRxiv - Cell Biology 2024Quote: ... shRNAs targeting luciferase or mouse Nr1h3 and Rara were cloned into the pLKO.1 vector (Addgene, MA, USA, #8453). The lentiviral vectors were co-transfected with the packaging vectors pCMV-deltaR8 (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... and an mEGFP plasmid with 1 kb homology arms (AICSDP-4:TUBA1B-mEGFP, Allen Institute, Addgene plasmid # 87421; RRID:Addgene_87421)41 mutated for the gRNA binding site ...
-
bioRxiv - Cancer Biology 2024Quote: ... Prokaryotic plasmids encoding GST-fusion proteins were constructed using pGEX-4T-1 bacterial expression vector (27-4580-01, Addgene). Mutants of His- ...
-
bioRxiv - Cancer Biology 2021Quote: ... HT-1080N cells were transduced with lentiviruses carrying the reverse tetracycline-controlled transactivator 3 under a CMV promoter (CMV-rtTA3) (Cat# w756-1, Addgene). HT-1080N-rtTA3 cell lines were selected in 10 μg/mL blasticidin (Cat # A1113902 ...
-
bioRxiv - Cancer Biology 2021Quote: The lentiviral constructs encoding mKO2-SLBP(18-126) and Clover-Geminin(1-110) were a gift from Michael Lin (Addgene plasmid # 83915 ...
-
bioRxiv - Cell Biology 2020Quote: ... and further subcloned into a CMV driven vector (pLenti CMV V5-LUC Blast (w567-1) was a gift from Eric Campeau (Addgene plasmid #21474 ...
-
bioRxiv - Cell Biology 2020Quote: Pairs of CRISPR guide RNA oligos (mouse Chmp5 single guide RNAs [sgRNAs] targeting GGCTCCGCCACCTAGCTTGA and GTTTCGCTTTTCCGAAGAAT on exon 1 respectively) were annealed and cloned into the BsmBI sites of lentiCRISPR V2-puro vector (plasmid 52961, Addgene). CRISPR lentiviral plasmids and lentiviral packaging plasmids (pMDLg/pRRE ...
-
bioRxiv - Immunology 2021Quote: ... a human RNH1-full coding sequence (ORIGEN RC 200082) insert was cloned into the entry vector pENTR4-GFP-C1 (W392-1, Addgene) and then recombined into the destination vector pLenti CMV Blast DEST (706-1 ...
-
bioRxiv - Immunology 2021Quote: RNH1-KO THP1 cells were infected with lentiviruses expressing RNH1 (pLenti CMV Blast GFP-RNH1) or the empty vector pLentiCMV-GFP-Blast (659-1, Addgene) as previously described (Papin et al. ...
-
bioRxiv - Microbiology 2019Quote: ... 2.18 μg of env-defective HIV-1 provirus containing GFP reporter was cotransfected with 0.31 μg pMD2.G VSV G plasmid (Addgene #12259). Simian immunodeficiency virus (SIV)−VLPs containing Vpx were produced by the transfection of 2.18 μg pSIV−Δpsi/Δenv/ΔVif/ΔVpr (Addgene #132928 ...
-
bioRxiv - Immunology 2019Quote: ... pMul1-FLAG and pAsc-Myc were subcloned into pLenti X2 Hygro DEST (a gift from Eric Campeau and Paul Kaufman, w17-1, #17295, Addgene) and transfected into HEK293T cells together with the helper plasmid (psPAX2 ...
-
bioRxiv - Microbiology 2019Quote: ... and cloned into EcoRV-cut pLenti CMV Puro DEST (w118-1) (gift from Eric Campeau & Paul Kaufman; Addgene plasmid # 17452) using NEBuilder® HiFi DNA Assembly Master Mix (New England BioLabs) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... to specifically target TP53 translation stop site and it was cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9-hGem (1/110) (Addgene #71707) according to the protocol of Ran et al.51 ...
-
bioRxiv - Neuroscience 2020Quote: ... Whole-cell patch-clamp recordings were also performed for functional evaluation of Cl− microdomains (Figure 1) on organotypic slices of DLX-Cre mice which were transfected on the day of slicing with tdTomato virus (Addgene-AAV9-CAG-FLEX-tdTomato ...
-
bioRxiv - Biochemistry 2020Quote: ... H-HCF-1) and full length human THAP11 cDNA with carboxy-terminal FLAG tag (Plasmid #28020; F-THAP11) were obtained from Addgene. Vectors containing full length human THAP1 cDNA with carboxy-terminal 1X FLAG tag (THAP1-F ...
-
bioRxiv - Biophysics 2020Quote: ... as per the manufacturer’s instructions into pLenti CMV Hygro DEST (W117-1, a gift from Dr. Eric Campeau & Dr. Paul Kaufman, Addgene #17454) to create the final vector which was sequence verified by Sanger sequencing (Australian Genome Research Facility) ...
-
bioRxiv - Cancer Biology 2020Quote: ... we designed single guide RNAs specifically targeting exon 1 of the mouse Bmal1 gene and subcloned it into the PX459 vector (Addgene) to obtain the PX459-Bmal1 plasmid ...
-
bioRxiv - Cancer Biology 2019Quote: ... was prepared by introducing four silent mutations into the sequence targeted by shNRF2 #1 in pEN_TT 3xFLAG-NRF2 (Addgene #136527). Site-directed mutagenesis was performed with the QuikChange II XL kit (Agilent).
-
bioRxiv - Cell Biology 2021Quote: ... NANOG and PRDM14 (see Table 1) were cloned into pLentiCRISPR V2 vectors with puro (SOX2, NANOG) or hygromycin B (PRDM14) resistance (Addgene plasmids #52961 and #98291 respectively ...
-
bioRxiv - Cell Biology 2021Quote: ... and pLKO.1 puro-based plasmid harboring the designed shRNA (pCMV-VSV-G and pLKO.1 puro were a gift from Bob Weinberg, Addgene plasmid #8454 ...
-
bioRxiv - Neuroscience 2020Quote: PV-Cre and SST-Cre slices were transfected in three different configurations: 1) 2.2 μL of ChETA (pAAV9-Ef1a-DIO-ChETA-EYFP Addgene#: 26968) and 1 μL of LSL-tdTomato (Addgene# ...
-
bioRxiv - Molecular Biology 2020Quote: A pET28a vector with sub-cloned cDNA of Hsp53-(1-73) (72R) and the N-terminal His-tag was procured from Addgene, (plasmid #62082) ...