Labshake search
Citations for Addgene :
1751 - 1800 of 2776 citations for 6' CHLORO 2' 3' DIHYDRO 1'H SPIRO CYCLOPROPANE 1 4' ISOQUINOLINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... we infected adult Brn3cCre mouse retinas with 1 ml Cre dependent AAV Virus (AAV2-CAG-FLEX-EGFP-WPRE, Addgene catalog # ...
-
bioRxiv - Cancer Biology 2021Quote: ... These pLKO.1 constructions were transfected in the 293T packaging cell line along with pMD2.G and pCMV-dR8.91 vectors (Addgene), following a typical Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... and a separate master mix was prepared comprising 1 mL Opti-MEM 8 µg PSPAX (12260, Addgene, Watertown, MA), 2 µg PMD2G plasmids (12259 ...
-
bioRxiv - Biochemistry 2020Quote: ... To generate mec-4p∷hrp-1 mScarlet plasmids, mScarlet (Bindels et al., 2017) was amplified from pmScarlet_C1 (Addgene 85042) and assembled into hrp-1HsLCWT using NEBuilder HiFi DNA Assembly kit and introducing the D290V mutation by Quickchange ...
-
bioRxiv - Cell Biology 2022Quote: ... then ligated into the pENTR1A no ccDB (w48-1) vector (a gift from Eric Campeau and Paul Kaufman, Addgene plasmid # 17398 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and SV40-T/t antigens expressing lentiviruses using vectors pLenti CMV-RasV12-Neo (w108-1) (HRAS G12V, #22259, Addgene), and pLenti-CMV/TO-SV40 small + Large T (w612-1 ...
-
bioRxiv - Cell Biology 2019Quote: ... pcDNA3.1 TEV (full-length) was a gift from Xiaokun Shu (Addgene plasmid #64276; http://n2t.net/addgene:64276; RRID: Addgene_64276)(To et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... Precission protease was produced as a GST fusion in Escherichia coli BL21 (DE3) from pGEX-6P-1 vector (Addgene). The cleaved Fc-fusion protein were passed through a protein-A column ...
-
bioRxiv - Molecular Biology 2021Quote: The cell cycle reporter vector pCSII-EF-miRFP709-hCdt(1/100) was a kind gift from Vladislav Verkhusha (Addgene plasmid # 80007 ...
-
bioRxiv - Pathology 2020Quote: ... all inserts were sub-cloned to an expression vector containing hygromycin resistance (pLenti CMV Hygro DEST 117-1, Addgene) using the Gateway recombination system ...
-
bioRxiv - Microbiology 2020Quote: The lentiviral vector was prepared by recovering the culture supernatant of 293T cells transfected with CSII-CMV-FNF-DsRed together with expression plasmids for HIV-1 Gag-Pol and Rev (pCMVR8.74, Addgene plasmid #22036 ...
-
bioRxiv - Microbiology 2020Quote: ... pcDNA3 HA eIF4GI (1–1599) was a gift from Nahum Sonenberg (Addgene plasmid #45640; http://n2t.net/addgene:45640; RRID Addgene_45640). The efficiency of expression was verified by western blotting.
-
bioRxiv - Microbiology 2020Quote: ... pShuttle-hACE2 was linearized with PmeI and subsequently cotransformed with the HuAdv5 backbone plasmid (pAdEasy-1 vector; Addgene 240005) into E ...
-
bioRxiv - Cell Biology 2021Quote: ... NatMX6 gene-replacement was performed by amplifying the NatMX6 cassette from the p41Nat 1-F GW plasmid (Addgene #58546) using 45 bp primers flanking the APS3 ORF ...
-
bioRxiv - Cell Biology 2020Quote: ... and mCCND1-CDK4-mVenus was inserted into the FRT site of RPE-1 FRT/TO mRuby-PCNA expressing in addition ectopic pCAGGs-NLS-TIR1_P2A_NES-TIR1 (Addgene: 117699). pCAGS-myc-BirA-P2A-3xflag-Avitag-UFM1-IRESpuro3 was electroporated into RPE-1 H3.1-mTurquoise2 + mRuby-PCNA UFM1 knockout cells followed by selection for stable integrands expressing 3xflag-Avitag-UFM1 to the same level as endogenous UFM1 (see Figure S4D ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lentiviral expression constructs were obtained by cloning CDA and CDAE67Q ORF into pCMV blasticidin DEST 706-1 vectors (Addgene) using the Gateway strategy (Invitrogen) ...
-
bioRxiv - Immunology 2020Quote: ... The recombinant DNA encoding TCRMART-1 was synthesized by GeneScript (Nanjing, China) and ligated into pRRLSIN.cPPT.PGK vector (Addgene, 12252).
-
bioRxiv - Molecular Biology 2021Quote: ... was modified to contain the H840A mutation from pCMV-PE2 [1] (a gift from David Liu, Addgene plasmid # 132775) by EcoRV and PmlI fragment sub-cloning ...
-
bioRxiv - Biochemistry 2021Quote: ... Jürg Müller (for generation of pcDNA5.1-FRT/TO-puro-(N)GFP-TEV-FLAG-3C-BAP1) or originated from Wade Harper’s laboratory obtained from Addgene (for generation of pcDNA5-FRT/TO-puro-eGFP-BAP1) ...
-
bioRxiv - Developmental Biology 2022Quote: Nek2 sgRNAs (Supplementary Table 1) were cloned into the CRISPR-Cas9 plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid 62988 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pT-mAppleT2Apuro(15.1kb) was generated by cloning a PacI/BamHI restriction enzyme fragment from pAdEasy-1 (Addgene, Plasmid#16400) into pT-mApple ...
-
bioRxiv - Neuroscience 2022Quote: ... Adeno-associated virus for expressing jGCaMP6f or jGCaMP7f under the synapsin-1 promoter (AAV1-syn-jjGCaMP6f-WPRE-SV40, Addgene, 100837 ...
-
bioRxiv - Plant Biology 2022Quote: ... The LacZ selection marker was PCR amplified with flanking BsaI sites into Level 1 acceptor vector pICH41780 (Addgene #48019) to allow blue-white screening for successful gRNA insertion into final ABE vectors ...
-
bioRxiv - Neuroscience 2022Quote: ... we used stereotactically targeted virus injections of rAAV S1 FLEX-CAG-jGCaMP7s-WPRE (Lot v28549, Addgene, #104495 AAV-1) into the MSDB of 3— 6 months old ChAT-Cre mice ...
-
bioRxiv - Neuroscience 2022Quote: ... or rAAV2/9 encoding for NIR-GECO2 under control of the synthetic CAG promoter (0.5 × 1012 -1 × 1013 gc/ml; AddGene plasmid #159603 ...
-
bioRxiv - Neuroscience 2022Quote: ... A retrograde GFP-tagged adeno-associated virus rAAV2/1-retro (retrograde AAV-CAG-GFP; serotype “retro”, Addgene, Cat. # 37825) was pressure injected into M2 (170 ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLenti CMV Puro LUC (w168-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17477; http://n2t.net/addgene:17477; RRID: Addgene_17477). For human BTIC injection into athymic nude mice ...
-
bioRxiv - Neuroscience 2023Quote: ... 1.3×1012 vg/mL) was mixed with AAV1-CAG-FLEX-EGFP-WPRE (Addgene; Cat # 51502; ≥ 1×1013 vg/mL) in a 4:1 ratio ...
-
bioRxiv - Genomics 2023Quote: ... We replaced the hU6-sgRNA cassette with the mU6-sgRNA cassette from pMK1334 (ref. 1) (Addgene plasmid #127965, RRID:Addgene_127965) by restriction cloning between sites MluI and XbaI ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA sequences were cloned into the 3rd generation transfer plasmid pLKO.1 TRC cloning vector (Addgene cat no. 10878) between unique AgeI and EcoRI sites downstream of the U6 promoter ...
-
bioRxiv - Neuroscience 2023Quote: ... a mixture of flexed AAV GFP (pAAV-FLEX-GFP-Virus, titer ≥ 1×10¹³ vg/mL, Addgene 28304-AAV PHPeB) and CamKII-Cre (pENN.AAV.CamKII 0.4.Cre.SV40 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/1.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (titer: 2.6·1013; a gift from Douglas Kim & GENIE Project, Addgene viral prep #100854-AAV1) was pressure-injected using a glass micropipette at ∼400 μm depth (200–250 nl per injection) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the sgRNA (see table 1) was cloned in to pX458 (Addgene plasmid no 48138(Ran, Hsu et al. 2013)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Single guide-RNA plasmids were generated by cloning oligonucleotides to the target site (see table 1) into pX335 (Addgene plasmid no ...
-
bioRxiv - Cancer Biology 2023Quote: ... and WDR6 (N-6xHis) coding sequences were codon-optimized for e.coli bacteria and cloned separately into petDuet-1 (purchased from Addgene) using the NcoI site downstream of the first T7 promoter ...
-
bioRxiv - Synthetic Biology 2023Quote: ... All plasmids that express GFPuv under the control of a phoB promoter were obtained from Addgene (supplemental table 1) 43,46 ...
-
bioRxiv - Neuroscience 2023Quote: We designed the syt-jGCaMP8s construct by linking the Drosophila synaptotagmin-1 coding sequences and jGCaMP8s (Addgene Plasmid #162380)69 using a GSGSGS linker ...
-
bioRxiv - Genomics 2023Quote: To create dual-enSERT-1 constructs, we used PCR4-Hsp68::lacZ-H11 plasmid (Kvon et al., 2020) (Addgene #139099) and replaced lacZ with eGFP or mCherry fluorescent reporters using Gibson cloning (Gibson et al. ...
-
bioRxiv - Biophysics 2023Quote: ... pLenti CMV rtTA3 Hygro (w785-1) was a gift from Eric Campeau (Addgene plasmid #26730; http://n2t.net/addgene:26730; RRID: Addgene_26730). pLenti CMV rtTA3 Hygro is called rtTA3 in the next sections.
-
bioRxiv - Immunology 2023Quote: ... a 4-1BB costimulatory domain and the CAR construct utilized for animals R.301-304 additionally expressed EGFRt.23 CARs were encoded by an xHIV plasmid which was co-transfected with an HIV-1 Rev/Tat and VSV-G envelope plasmid (RRID:Addgene_138479) for lentiviral production as previously described.23
-
bioRxiv - Neuroscience 2024Quote: The shRNA construct for mouse aldolase A was generated using oligos directed towards the 3’UTR of Aldoa (GCCCACTGCCAATAAACAACT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) and cloned into the pLKO.1 cloning vector (Addgene Cat# 10878, RRID:Addgene_10878) and pCGLH vector for lentivirus and in utero electroporation experiments ...
-
bioRxiv - Cancer Biology 2023Quote: ... A 10-μl Hamilton syringe was used to infuse 1 μl of AAV1/Syn-GCaMP6f-WPRESV40 (titer 4.65 × 1013 GC per ml, via Addgene) into the parabrachial nucleus (−5.3 mm anteroposterior ...
-
bioRxiv - Neuroscience 2024Quote: ... a total volume of 10-20 ul of AAVrg-FLEX-taCasp3-TEVp (titer >1 × 1012 pfu/ml; Addgene 45580) was injected into the medial and left lobes of the livers of AvilCreERT2 mice ...
-
bioRxiv - Neuroscience 2024Quote: ... A genetically encoded calcium indicator for the detection of ACh activity (1 μL, AAV9-hSyn-ACh3.0; AddGene; Watertown, MA) was infused into the medial prefrontal cortex (AP(2.7mm) ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV injections consisted of a 1:10 cocktail of Cre [AAV5-CMV-HI-eGFP-Cre.WPRE.SV40 (Addgene plasmid no. 105545) packaged at UPenn Vector Core 2.5 × 1014 GC ml−1] and KORD [AAV8-HSyn-DIO-HA-KORD-IRES-mCitrine (Addgene plasmid no ...
-
bioRxiv - Cell Biology 2024Quote: ... shRNAs targeting luciferase or mouse Nr1h3 and Rara were cloned into the pLKO.1 vector (Addgene, MA, USA, #8453). The lentiviral vectors were co-transfected with the packaging vectors pCMV-deltaR8 (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... Prokaryotic plasmids encoding GST-fusion proteins were constructed using pGEX-4T-1 bacterial expression vector (27-4580-01, Addgene). Mutants of His- ...
-
bioRxiv - Neuroscience 2022Quote: ... one group of animals (n=6) received a bilateral injection of a virus driving expression of the calcium indicator GCaMP7s (AAV9-hSyn-GCaMP7s-WPRE; Addgene; 300nL per side) targeting the CA1v at the following stereotaxic coordinates ...
-
bioRxiv - Cell Biology 2020Quote: ... mCherry-Mito-7 and mCherry-ER-3 were kindly provided by Michael Davidson (Addgene plasmids #55102 and #55041).
-
bioRxiv - Cell Biology 2020Quote: ... a fragment containing the 3×Flag-nls-cas9-nls coding sequence isolated from pBS-Hsp70-cas9 (Addgene, #46294) with same enzymes was inserted ...