Labshake search
Citations for Addgene :
1651 - 1700 of 1931 citations for tert Butyl 2 chloro 5H pyrrolo 3 4 b pyridine 6 7H carboxylate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... pENTR4-FLAG (w210-2) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17423 ; http://n2t.net/addgene:17423 ; RRID:Addgene_17423), pGP (retroviral Pol and Rev gene plasmid ...
-
bioRxiv - Biochemistry 2023Quote: ... The SARS-CoV-2 Spike ectodomain Hexa-pro construction (Table 1) was a gift from Jason McLellan (Addgene # 154754 ...
-
bioRxiv - Cell Biology 2023Quote: ... UGGT2-/- and UGGT1/2-/-HEK 293T cells were generated using the CRISPR/Cas9 system from Addgene (http://www.addgene.org/). The sequences for guide RNAs were obtained from http://tools.genome-engineering.org and https://www.addgene.org/pooled-library/zhang-human-gecko-v2/ ...
-
bioRxiv - Neuroscience 2023Quote: ... rats received 2 separate unilateral microinjections (males 0.2 µL, females 0.15 µL) of retrograde-transported AAV (AAVretro) constructs (Addgene) in the RVLM and CVLM (RVLM-males ...
-
bioRxiv - Biochemistry 2024Quote: ... and T7 Ocr (NCBI Accession # NP_041954.1) genes were cloned into UC Berkeley Macrolab vectors 2-BT (Addgene #29666) and 13S-A (Addgene #48323 ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were transfected with either (G4C2)92 and (G4C2)2 lentiviral transfer plasmids along with PAX (Addgene #12260) and VSV-G (Addgene #12259 ...
-
bioRxiv - Immunology 2024Quote: ... The plasmid pcDNA3.1 SARS-CoV-2 S D614G was a gift from Jeremy Luban (Addgene plasmid # 158075; http://n2t.net/addgene:158075; RRID:Addgene_158075). The RBD amino acid sequence 328-537 encoded in this plasmid is identical to the sequence of RBD that we studied here ...
-
bioRxiv - Microbiology 2024Quote: ... The plasmid pcDNA3.1 SARS-CoV-2 S D614G was a gift from Jeremy Luban (Addgene plasmid # 158075; http://n2t.net/addgene:158075; RRID:Addgene_158075). The RBD amino acid sequence 328-537 encoded in this plasmid is identical to the sequence of RBD that we studied here ...
-
bioRxiv - Cell Biology 2022Quote: ... pEGFP-ZO-2 was a gift from Marius Sudol (Addgene plasmid # 27422; http://n2t.net/addgene: 27422; RRID: Addgene_27422) (Oka et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... YAP–HaloTag CRISPR knock-in U-2 OS cells were transfected with pEGFP-C3-Lats1 (Addgene plasmid # 19053) or pEGFP C3-Mst2 (Addgene plasmid # 19056) ...
-
bioRxiv - Microbiology 2022Quote: ... pGBW-m4252984 (SARS-CoV-2 E [envelope]) was a gift from Ginkgo Bioworks (Addgene plasmid #153898; http://n2t.net/addgene:153898; RRID:Addgene_153898). MLV-gag/pol ...
-
bioRxiv - Molecular Biology 2022Quote: All engineered SARS-CoV-2 S variant ectodomains were designed based on the HexaPro gene (Addgene plasmid #154754) containing stabilizing proline mutations at positions F817P ...
-
bioRxiv - Cell Biology 2023Quote: Day 5 moDCs previously transfected with either NT or gal9 siRNA were transfected with 2 ug of the Str-KDEL_TNFα_SBP_EGFP plasmid (Addgene, #65278) (Boncompain et al ...
-
bioRxiv - Biochemistry 2023Quote: ... P05771-2) was a gift from William Hahn & David Root (Addgene plasmid #23746; http://n2t.net/addgene: 23746; RRID:Addgene_23746) (Johannessen et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... The pWPXLd-OGT-GFP fusion vector was described in our previous articles,(2) pET24a-ncOGT-FL (190821, Addgene), other plasmids were cloned into pcDNA3.1 backbone with c-myc or HA tag ...
-
bioRxiv - Biochemistry 2024Quote: BFP- and sgRNA-encoding lentiviruses were produced by co-transfecting 2 µg of pCMV-VSV-G (Addgene, #8454), 3 µg of psPAX.2 (Addgene ...
-
bioRxiv - Synthetic Biology 2024Quote: ... were made electrocompetent using our standard protocol2 and electroporated with pORTMAGE-2 (Addgene plasmid # 72677; http://n2t.net/addgene:72677; RRID:Addgene_72677) or alternatively ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Gentamicin-R and Kanamycin-R) were made electrocompetent using our standard protocol2 and electroporated with pORTMAGE-2 (Addgene plasmid # 72677 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2-EF1a-DIO-eNpHR3.0-EYFP-WPRE-pA (4.0 × 1012 vg/mL, 1:2 dilution, UNC vector core using Addgene plasmid #26972 ...
-
bioRxiv - Biophysics 2024Quote: ... HEK293T cells were co-transfected with DuProSense biosensor containing Mpro cleavage sites and pLVX-EF1alpha-SARS-CoV-2-nsp5-2×Strep-IRES-Puro (Mpro WT) (a gift from Nevan Krogan; Addgene #141370; http://n2t.net/addgene:141370; RRID:Addgene_14137)96 (Fig ...
-
bioRxiv - Biophysics 2024Quote: HEK293T cells were co-transfected with mSca-containing DuProSense biosensor plasmid DNA and either pLVX-EF1alpha-SARS-CoV-2-nsp5-2×Strep-IRES-Puro (Mpro) (a gift from Nevan Krogan; Addgene #141370; http://n2t.net/addgene:141370; RRID:Addgene_14137)96 or Nsp3-EGFP (PLpro ...
-
bioRxiv - Biophysics 2024Quote: ... equal amounts of both pLVX-EF1alpha-SARS-CoV-2-nsp5-2×Strep-IRES-Puro (Mpro) (a gift from Nevan Krogan; Addgene #141370; http://n2t.net/addgene:141370; RRID:Addgene_14137)96 and Nsp3 -EGFP (PLpro ...
-
bioRxiv - Biophysics 2024Quote: ... and pmNG-Mpro-NLuc-PLpro-mScarlet either alone or co-transfected with either pLVX-EF1alpha-SARS-CoV-2-nsp5-2×Strep-IRES-Puro (Mpro WT) (a gift from Nevan Krogan; Addgene #141370; http://n2t.net/addgene:141370; RRID:Addgene_14137)96 or Nsp3 -EGFP (PLpro WT ...
-
bioRxiv - Biophysics 2024Quote: HEK293T cells were co-transfected with mSca-containing DuProSense biosensor plasmid DNA and pLVX-EF1alpha-SARS-CoV-2-nsp5-2×Strep-IRES-Puro (Mpro) (a gift from Nevan Krogan; Addgene #141370; http://n2t.net/addgene:141370; RRID:Addgene_14137)96 plasmid DNA in 96-well white flat bottom plates ...
-
bioRxiv - Biophysics 2024Quote: ... along with either pLVX-EF1alpha-SARS-CoV-2-nsp5-2×Strep-IRES-Puro (Mpro) (a gift from Nevan Krogan; Addgene #141370; http://n2t.net/addgene:141370; RRID:Addgene_14137)96 or Nsp3 -EGFP (PLpro ...
-
bioRxiv - Biophysics 2024Quote: ... HEK293T cells were co-transfected with mSca-containing DuProSense biosensor plasmid along with pLVX-EF1alpha-SARS-CoV-2-nsp5-2×Strep-IRES-Puro (Mpro WT) (a gift from Nevan Krogan; Addgene #141370; http://n2t.net/addgene:141370; RRID:Addgene_14137)96 and Nsp3 -EGFP (PLpro WT ...
-
bioRxiv - Bioengineering 2024Quote: ... and [2] pRSV-Rev was a gift from Didier Trono (Addgene plasmid 12253 ; http://n2t.net/addgene:12253 ; RRID:Addgene_12253)) altogether with transfer vector into Hek cells delivered by lipofectamine 3000 reagent ...
-
bioRxiv - Neuroscience 2023Quote: ... each of these viruses were mixed in a 4:1 ratio with AAV8-Ef1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA (Addgene; Watertown, MA, USA) and injected with 300 nL per side ...
-
bioRxiv - Cell Biology 2023Quote: ... pcDNA3.1-myc-OGA(1-400) and (344)pcDNA3.1(+)-HA-nLaG6-(EAAAK)4-OGA(544-706)15 (gift from Christina Woo; Addgene plasmid 168095 and 168197). Additionally ...
-
bioRxiv - Cancer Biology 2024Quote: HEK293 cells were cultured in 6-well plates and then transfected with 4 μg of previously described plasmid vectors encoding ER stress reporter genes ATF4-mS (#115970, Addgene, Cambridge, MA, USA), XBP1-mN (#115971) ...
-
bioRxiv - Cell Biology 2024Quote: ... expressing a gRNA targeted against hTUBA1B (gGATGCACTCACGCTGCGGGA) and an mEGFP plasmid with 1 kb homology arms (AICSDP-4:TUBA1B-mEGFP, Allen Institute, Addgene plasmid # 87421; RRID:Addgene_87421)41 mutated for the gRNA binding site ...
-
bioRxiv - Neuroscience 2024Quote: ... For fiber photometry experiments Fig 4 and 4S: dual virus strategy of AAVretro-pEF1a-DIO-FLPo-WPRE-hGHpA (Addgene; 87306-AAVrg; 7×10e12) in PPN and AAVDJ-hEF1a-dFRT-jGCaMP7s(rev)-dFRT-WPRE-hGHp(A ...
-
bioRxiv - Developmental Biology 2021Quote: ... using program A-30 with 1.6 µg each of GFP and tdTomato circularised targeting vectors and 5 µg single gRNA vector PX459 (5’-TATACCTAATCATTATGCCG-3’) (Addgene, 48139, a gift from Feng Zhang). Homology arms flanking the target site were amplified from genomic DNA and cloned into pBluescript II SK(+ ...
-
bioRxiv - Cell Biology 2023Quote: ... JR20s were used to express Cas9 and our previously verified sgRNA (5’-TCGACAGCCTTATGGCGGAC-3’) targeting mouse PFN120 from pLentiCRISPRv2 (Addgene #52961; a gift from Feng Zhang) via lentiviral transduction ...
-
bioRxiv - Cancer Biology 2023Quote: ... The alleles also contain mutations that confer resistance to CRISPR/Cas9 editing (without changing the amino acid sequence) with all the sgRNAs against LKB1 in the Toronto Knockout version 3 (TKOv3) CRISPR library (Addgene 125517, a gift from Jason Moffat). These alleles were then cloned into pBABE-GFP (Addgene 10668 ...
-
bioRxiv - Cell Biology 2022Quote: ... IFT121 and IFT139 in IMCD-3 cells were designed using Benchling software and cloned into the pX330 vector (gift from Feng Zhang; Addgene plasmid # 42230; (Cong et al., 2013)) ...
-
bioRxiv - Developmental Biology 2024Quote: ... and guide RNAs were cloned into plasmid pCFD3-dU6:3 (for Dlp, Mad and Med) or pCFD4-U6:1_U6:3 (for Babo, Brk, Dad, Sax, Shn, Smad2 and Wit) (Addgene #49410 and #49411, (Port et al., 2014)) ...
-
bioRxiv - Genetics 2020Quote: A pair of TALENs targeting zebrafish tnfaip3 (A20) exon 2 were generated using “PLATINUM Gate TALEN Kit” (Addgene, #1000000043). 0.2 ng of mRNA encoding the TALEN pair was delivered into the cytoplasm of wild-type zebrafish embryos at the one-cell stage ...
-
bioRxiv - Molecular Biology 2020Quote: ... These parental BV2 or BV2-Cas9 cells were transduced for 2 d with pXPR_011 lentivirus expressing eGFP (Addgene; 59702) and an sgRNA targeting eGFP at a multiplicity of infection (MOI ...
-
bioRxiv - Neuroscience 2021Quote: ... Pups were injected bilaterally with 2 μl of AAV9-hsyn-ACh3.0 (1.8×10^13 gc/ml) and 2 μl of AAV9-hsyn-NES-jRCaMP1b (2.5×10^13 gc/ml, Addgene) per hemisphere ...
-
bioRxiv - Systems Biology 2021Quote: ... We generated two independent miR-290-295_KO mESC lines by transfecting WT E14 mESCs with pX458-sgRNA_miR290-295_3/2 for KO1 (Addgene #172711, #172710) and pX458-sgRNA_miR290-295_1/2 for KO2 (Addgene #172709 and #172710) ...
-
bioRxiv - Microbiology 2021Quote: ... pCDNA3.1-SARS2-Spike expressing full-lengh Spike (S) protein from SARS-CoV-2 (GenBank accession number QHD43416.1) was purchased from Addgene. Expression plasmid encoding S protein from SARS-CoV (GenBank accession number AAP13567.1 ...
-
bioRxiv - Cell Biology 2021Quote: ... Two closely spaced NHSL1 specific sgRNA (sgRNA1: caccgTCGACTCTCCTCGTCCAAGT; sgRNA2: caccgCTGTCCACTACACGGCACCA) were designed using http://crispr.mit.edu and cloned into pX330S-2 (Addgene 58778) and pX330A_D10A_x2 (Addgene 58772 ...
-
bioRxiv - Molecular Biology 2022Quote: The lentiviral vectors pLVX-EF1alpha-IRES-Puro-2xStreg-SARS-CoV-2 (Nsp6, Nsp8, M) (Addgene plasmids #141395, #141372, #141374) were transfected into the HEK293T cells with packaging plasmids ...
-
bioRxiv - Cancer Biology 2022Quote: ... SCD ORF was cloned in pLenti PGK Puro DEST 5W(w529-2) (gift from Eric Campeau & Paul Kaufman73; Addgene plasmid #19068 ...
-
bioRxiv - Neuroscience 2022Quote: ... 200nl of adeno-associated virus 2 (AAV2) containing either control construct (pAAV-hSyn-EGFP; plasmid #50465; Addgene, Watertown, MA) or excitatory DREADD (pAAV-hSyn-hM3D(Gq)-mCherry ...
-
bioRxiv - Microbiology 2021Quote: ... The pcDNA-FLAG-V5-Nsp10/14/16 vectors were constructed from pDONR223 SARS-CoV-2 Nsp10 (Cat. # 141264, Addgene), Nsp14 (Cat ...
-
bioRxiv - Developmental Biology 2021Quote: ... Two guides were designed using the http://crispr.mit.edu tool (guide 1: CGGCTACTCCACTGTGGCGG; guide 2: CGCTTCTTGGGCCGGATGAG) and were cloned into the pX458 plasmid (Addgene, #48138) as previously described (55) ...
-
bioRxiv - Immunology 2021Quote: ... Virus was harvested from GP-2 cells transfected with SINV vectors and VSV-G (pMD2.G, Addgene plasmid #12259) and grown in DMEM supplemented with 30% FBS and 2mM glutamine ...
-
bioRxiv - Cancer Biology 2020Quote: shRNAs from the library (Supplemental Table 2) were annealed and cloned into a pLKO.1_neo plasmid (a gift from Sheila Stewart; Addgene plasmid # 13425 ...