Labshake search
Citations for Addgene :
1651 - 1700 of 2074 citations for Acetamide N 5 bis 2 hydroxyethyl amino 2 2 chloro 4 6 dinitrophenyl azo 4 methoxyphenyl since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... 5 μg Cas9 expression plasmid pSpCas9(BB)-2A-Puro (Addgene, PX459) was stably transfected into 8×105 DBA/2 ES cells via electroporation ...
-
bioRxiv - Physiology 2023Quote: ... working dilution 1:5) or d-Light1 (pAAV-CAG-dLight1.1, Addgene viral prep # 111067-AAV5 ...
-
bioRxiv - Neuroscience 2022Quote: ... titer: 5 × 1012 GC/ml (Addgene viral prep # 18917-AAV1, RRID:Addgene_18917), and
-
bioRxiv - Biophysics 2022Quote: ... 5 μM Sfp synthase (plasmid obtained from Addgene (pET-Sfp, #159617) and purified as described (Yin et al ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV8-nEF-Con/ Fon-TVA-mCherry (Addgene 131779, 5×1012 titer) and AAV8-EF1α-Con/Fon-oG (Addgene 131778 ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV8-EF1α-Con/Fon-oG (Addgene 131778, 5×1012 titer) were mixed in equal proportions (final titer = 2.5×1012 each ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV2/9-pAAV-hDlx-hM4Di-dTomato-Fishell-5 (Addgene, 83896) at a concentration of 6+13 genome copies per ml (gc/ml) ...
-
bioRxiv - Molecular Biology 2024Quote: ... R-5’ CAGACGCGTTTAGCCCTCCCACACATAACCAGA 3’ from pLKO.1-Blasticidin vector (Addgene #26655), and ligated after AgeI and MluI digestion and gel purification with the vector backbones ...
-
bioRxiv - Cancer Biology 2020Quote: ... to co-transfect pBABE-puro or pBABE-puro.SLX4IP.3xFLAG with pCMV-VSV-G (at a ratio of 6:1, Addgene#8454) into GP2-293 cells (Clontech) ...
-
bioRxiv - Molecular Biology 2022Quote: ... in 6-well plates (1.5×106 cells/well) and co-transfected with the cAMP sensor Pink Flamindo (Addgene plasmid #102356) and either empty vector or the given GPR126 construct in the pULTRA vector on the next day using Lipofectamine 2000 according to the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2020Quote: ... annealed oligonucleotides (Supplementary Table 6) were cloned into a BsaI site of a gRNA expression vector (Addgene Plasmid number 41824) 65 and correct insertion was determined by Sanger sequencing with the SP6 primer (Supplementary Table 6) ...
-
bioRxiv - Neuroscience 2020Quote: ... a series of 6 - 10 microinjections (50 - 100 nL each, 200-300 μm depth) of AAV5.Flex.ArchT.tdTomato (Addgene, #28305-AAV5) were delivered along the posterior to anterior axis of RSC (2.0 to 4.0 mm posterior ...
-
bioRxiv - Bioengineering 2020Quote: ... 400,000 HEK cells were seeded in 6-well plates and the next day transfected with 1 μg psPAX2 (Addgene #12260), 3 μg pCMV-VSV.G (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: The plasmid containing codon-optimized GAL80 sequence driven by a tubulin promoter is a gift from Allison Bardin and corresponds to the combination of pattB-tubP-SV40 - generated by Lee and Luo (Lee and Luo, 1999)-with the codon optimized GAL80 sequence from pBPGAL80Uw-6-a gift from Gerald Rubin (Addgene plasmid #26236 ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were transfected with a 6:1 ratio of a firefly luciferase reporter plasmid driven by a pGL3-RARE-responsive promoter (Addgene) and a Renilla luciferase reporter plasmid driven by a constitutive CMV promoter (Promega) ...
-
bioRxiv - Biochemistry 2021Quote: ... and all described mutants were independently cloned and expressed as a 6× His-SUMO fusion proteins from the expression vector pAL (Addgene). These were cloned utilizing primers in Table S3 ...
-
bioRxiv - Neuroscience 2023Quote: ... The following viruses were injected:: AAV5-hSyn-DIO-hM3Dq-mCherry (DREADD-Gq, titer 6 × 1012 cfu/ml, 250ul bilateral, #44361, Addgene), AAV5-hSyn-DIO-mCherry (control ...
-
bioRxiv - Neuroscience 2022Quote: ... 6 mice from each line were injected bilaterally with a pAAV9-CAG-Flex.GCaMP6s.WPRE.SV40 virus (Addgene, titre ≥ 1×1013 vg/mL) in the medial NAc shell (D1-cre and D2(A2a)-cre mice ...
-
bioRxiv - Biochemistry 2023Quote: ... the C162A mutant and the C162L mutant were independently cloned and expressed as 6× His-SUMO fusion proteins from the expression vector pAL (Addgene). BL21 (DE3 ...
-
bioRxiv - Developmental Biology 2023Quote: ... expressing a dominant negative variant of the rol-6 gene and an empty vector pSK (up to 200 ng μl-1 of DNA) (Addgene) using standard methods (42) ...
-
bioRxiv - Neuroscience 2023Quote: For Synaptic plasticity experiments C57Bl/6-Jax mice were injected with AAV-Chronos (pAAV-Syn-Chronos-GFP, Addgene 59170-AAV5) virus in area S2 at locations and concentrations given in Table M2.
-
bioRxiv - Cancer Biology 2024Quote: Two independent sgRNAs (Supplementary Table 6) were designed for each target gene and cloned into lentiCRISPRv2-blast vector (Addgene #83480) or lentiCRISPRv2-puro vector (Addgene #52961 ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were seeded per well of a 6-well plate and co-transfected with 2.8 µg pHAGE-mKeima-LGALS3 (Addgene; 175780), 2.3 µg pPAX2 (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... 700,000 HEK293T cells were seeded onto a 6-well plate and 24 hours later transfected with 200 ng pMD2.G (Addgene), 400 ng psPAX2 (Addgene) ...
-
bioRxiv - Immunology 2024Quote: 293T cells were seeded in 6-well plates and transfected with the prISG15-Renilla-hPEST-IRES-Puro construct together with psPAX2 and pMD2.G (Addgene plasmids #12259 and #12260 ...
-
bioRxiv - Neuroscience 2024Quote: ... where a 6-residue histidine tag was inserted at the 587 aa position in the pAAV2-N587X plasmid (Addgene, #130877).
-
bioRxiv - Neuroscience 2024Quote: ... and inserted into sites of GFP in pAAV/L7-6-GFP-WPRE (a gift from Hirokazu Hirai, Addgene plasmid # 126462) (pAAV-L7-6-jGCaMP7f and pAAV-L7-6-jGCaMP7s ...
-
bioRxiv - Neuroscience 2024Quote: ... We re-amplified the rat Slc9a6 cDNA from the TOPO vector and cloned into pAAV-L7-6-GFP-WPRE15 (Addgene, Plasmid #126462 ...
-
bioRxiv - Neuroscience 2024Quote: ... The lentiviral construct for RELN expression was generated by subcloning domains 3–6 (central domains) of RELN from the pCrl construct (Addgene #122443 ...
-
bioRxiv - Genomics 2024Quote: ... 15 million HEK293T cells were transfected 15 million HEK293T cells were grown overnight on 15 cm poly-L-Lysine coated dishes and then transfected with 6 ug pMD2.G (Addgene plasmid # 12259 ...
-
bioRxiv - Cell Biology 2024Quote: ... Lentivirus for individual sgRNAs was prepared in 6-well plates by co-transfecting 293Ts with 1.06 ug pMDLG (Addgene #12251), 0.57 ug pMD2G (Addgene #12259) ...
-
bioRxiv - Developmental Biology 2024Quote: The lentiviral construct for RELN expression was generated by subcloning domains 3–6 (central domains) of RELN from the pCrl construct (Addgene #122443 ...
-
bioRxiv - Cell Biology 2024Quote: ... N-terminal FLAG-tagged CAPS was created by recombining the human CAPS gene (CAPS/pENTR; DNAsu HscD00514950) into pEZFLAG (Addgene#18700; Guo et al., 2008) using Gateway cloning ...
-
bioRxiv - Molecular Biology 2020Quote: ... The resin was washed 6 times with lysis buffer (supplemented with 100 nM USP2 (purified in-house from Addgene plasmid 36894) for de-ubiquitinated TOP2B) ...
-
bioRxiv - Cell Biology 2022Quote: ... the following packaging and envelop plasmids were added to all of the 10-cm dishes as well: psPAX2 (6 μg) and pMD2.G (0.75 μg, Addgene, catalog #: 12259). psPAX2 (Addgene plasmid # 12260 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... approximately 500,000 cells in 6-well plates were transfected with 2000ng dCas9-KRAB-MeCP2-containing PiggyBac expression plasmids (Addgene plasmid #110821) and 400ng of transposase vector PB200PA-1 using PEI ...
-
bioRxiv - Genetics 2021Quote: ... 2 ml (1.5× 106/ml) cells plated in a well of a 6-well dish were transfected with 300 ng of Act::Cas9 (Addgene #62209) and the respective gRNA and repair templates for the 25C6 (75 ng pU6-3-25C6-gRNA1 (DGRC Cat# 1547) ...
-
bioRxiv - Immunology 2021Quote: ... HEK293T cells were seeded in 6-well plates and the next day transfected with 1 μg psPAX2 packaging plasmid (Addgene 12260), 500 ng pMD2.G VSV-G envelope plasmid (Addgene 12259 ...
-
bioRxiv - Cancer Biology 2020Quote: ... were electroporated (6 square wave pulses, 0.1ms interval, 175V) with a pX458 vector (a gift from Feng Zhang; Addgene plasmid #48138) containing an Rpl10 targeting gRNA (5’-TGATACGGATGACATGGAAA-3’ ...
-
bioRxiv - Neuroscience 2020Quote: ... Additional viral constructs were assembled for Cre-dependent expression of a reporter under the control of the Dlx5/6 enhancer: AAV-Dlx-Flex-GFP (Addgene #83900) and AAV-Dlx-Flex-ChR2-mCherry (Dimidschstein et al. ...
-
bioRxiv - Immunology 2024Quote: 8 x 105 293T cells were seeded in 6-well plate and transfected with pcDNA3-FLAG-VSVG plasmids (Addgene, plasmid 80606) for 24 hours with 50 μl of purchased or previously collected VSVΔG-Luc pseudovirus (Kerafast ...
-
bioRxiv - Genomics 2024Quote: ... 4.5 x 106 cells were transfected using the calcium phosphate precipitation method (Salmon and Trono, 2007) with 6 μg pMD2.G (Addgene #12259), 15 μg psPAX2 (Addgene #12260 ...
-
bioRxiv - Genetics 2023Quote: We plated 550,000 HEK293T cells on 6-well plates and 24 hours later we transfected the cells with 900 ng psPAX2 packaging vector (Addgene #12260), 360 ng pMD2.g VSV-G envelope vector (Addgene #12259) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1x penicillin/streptomycin (pen/strep; PAA) and distributed in 6-well plates with HEK293 cells transfected with Neo1.a-AP-His (Addgene #71963) or pcDNA3.1-CNTN4-FLAG ...
-
bioRxiv - Biophysics 2023Quote: ... HEK293T cells were seeded at a confluency of ∼70 % in T75 flasks and co-transfected 6 hours later with 7.5 µg of the lentiviral packaging vector psPAX2 (gift from Didier Trono - Addgene plasmid # 12260) and 15 µg of the plasmid encoding the respective viral surface protein (pCMV14-3X-Flag-SARS-CoV-2 S was a gift from Zhaohui Qian - Addgene plasmid # 145780 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentivirus expressing either Bmal1- or Per2-promoter driven luciferase reporter was produced by transfecting HEK293T cells with 6 µg psPAX2 (Addgene #12260), 3.6 µg pMD2G (Addgene #12259 ...
-
bioRxiv - Immunology 2024Quote: ... HEK293Ts at >70% confluency in a 6-well TC-treated plate were transfected with 0.468 μg VSV-G (pMD2.G, Addgene plasmid #12259), 1.17 μg D8.9 packaging vector ...
-
bioRxiv - Neuroscience 2024Quote: hCMEC/D3 brain endothelial cells were grown to confluency in 6-well culture plates and transfected with 1µg of a β-Catenin luciferase reporter plasmid (M50 Super 8x TOPFlash - Addgene #12456) and 35ng of Renila reporter plasmid (pRL-TK Promega #E2231 ...
-
bioRxiv - Genomics 2024Quote: ... HEK293 cells were seeded at 1.2×106 cells per well of 6-well plate and transfected with pMD2.G (Addgene plasmid # 12259), pCMVR8.74 (Addgene plasmid # 22036 ...
-
bioRxiv - Bioengineering 2024Quote: ... was used in conjunction with one of three different RepCap plasmids (7m8,5 Addgene, #64839; pAAV-DJ,6 Cell Biolabs, VPK-420-DJ; pAAV2/1, Addgene, #112862), and a self-complementary AAV cargo vector (see design below ...