Labshake search
Citations for Addgene :
1651 - 1700 of 3548 citations for 7 Amino 1 3 dimethyl 1H 8H pyrido 2 3 d pyrimidine 2 4 5 trione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... All cell lines presented in this study are available from the corresponding author upon request and all plasmids are available from Addgene (Supplementary Table 2).
-
bioRxiv - Cancer Biology 2020Quote: ... HEK293T cells were transfected with psPAX2 and pMDG.2 packaging plasmids (gifts from Didier Trono, EPFL, Lausanne, Switzerland; Addgene plasmids 12559 and 12660) and the lentiviral expression construct ...
-
bioRxiv - Microbiology 2022Quote: ... were cloned from pLVX- EF1alpha-SARS-CoV-2-M-2xStrep-IRES-Puro and pLVX-EF1alpha-SARS-CoV-2-E-2xStrep- IRES-Puro (kind gifts from Nevan Krogan, available from Addgene #141386 and #141385) using PCR to remove the 2xStrep epitope tag ...
-
bioRxiv - Neuroscience 2020Quote: One adult mouse (~ 2 months) was stereotaxically injected with a GCaMP6f construct (AAV5.CamKII.GCaMP6f.WPRE.SV40 virus, Addgene # 100834; 0.4 μL at 0.06 μl/min) in hippocampal CA1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... HEK293T cells were transfected with psPAX2 and pMDG.2 packaging plasmids (gifts from Didier Trono, EPFL, Lausanne, Switzerland; Addgene plasmids 12559 and 12660), the lentiviral expression plasmid ...
-
bioRxiv - Biophysics 2022Quote: The plasmid encoding GPCR kinase subtype 2 used for the receptor phosphorylation in insect cells (GRK2-CAAX) was a gift from Robert Lefkowitz (Addgene plasmid #166224 49). Full-length arrestin21-418 (C150L ...
-
bioRxiv - Cancer Biology 2022Quote: ... shNFATC2IP#2: ACATTTGCTTGAGGCTTATAC) were cloned into Tet-pLKO-puro or TET-pLKO-neo vectors (gifts from Dmitri Wiederschain, Addgene plasmids #21915 and #21916). Hairpins were introduced by lentiviral transduction using pRSV-Rev (Addgene plasmid # 12253) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 μg pUMVC (Addgene, 8449) and 18 μg transfer plasmid were mixed in 700 μL DMEM medium (Corning ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 μl of AAV2/5-GfaABC1D-Lck-GCaMP6f (1013 genome copies/ml) (Addgene viral prep # 52924-AAV5) was injected into the DLS ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 virus (500 nL, titer ≥ 1X1013 vg/mL, working dilution 1:5, Addgene, #100833-AAV9; https://www.addgene.org/100833/RRID:Addgene_100833) was injected unilaterally into the DS (L = ±1.5 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... we have cloned their respective oligonucleotides in following vectors: PDX1 in pX330A-1×5 (Plasmid #58769, Addgene), NKX6.1 in pX330S-2 (Plasmid #58778 ...
-
bioRxiv - Physiology 2023Quote: ... pAAV-GfaACC1D.Lck-GCaMP6f.SV40 (1.53×1013 vg/ml, working dilution 1:5, Addgene plasmid #52925-AAV5; http://www.addgene.org/52295/; RRID: Addgene_52925) was a gift of Baljit Khak ...
-
bioRxiv - Neuroscience 2024Quote: ... sechellia nos-Cas9 (Auer et al., 2020) or co-injected with pHsp70-Cas9 (400 ng μl−1) (Addgene #45945; for D. simulans transgenesis) (Gratz et al. ...
-
bioRxiv - Biochemistry 2020Quote: Recombinant wild-type Streptococcus pyogenes Cas9 REC3 domain (506-712) possessing an amino-terminal His10-MBP tag (Addgene, no. 101205) followed by a TEV protease site was expressed in Escherichia coli strain BL21(DE3 ...
-
bioRxiv - Molecular Biology 2020Quote: Human Drosha cDNA with a Flag-tag at the amino-terminus was cloned into pBABE-puro vector (Addgene plasmid#1764) for producing retrovirus of human Drosha wild type (WT) ...
-
bioRxiv - Microbiology 2021Quote: pLenti.GFP.NLuc is a dual GFP/nanoluciferase lentiviral vector based on pLenti.CMV.GFP.puro that contains a GFP/nanoluciferase cassette separated by a picornavirus P2A self-processing amino acid motif cloned into the BamH-I and Sal-I sites (Addgene plasmid #17448 ...
-
bioRxiv - Cell Biology 2022Quote: ... mKeima-Red-Mito-7 plasmid was a gift from Michael Davidson (Addgene plasmid #56018; www.addgene.org/56018). MitoTracker Deep Red FM ...
-
bioRxiv - Neuroscience 2021Quote: ... 200 nL total of AAVrg-hSyn-GFP (Addgene 50465-AAVrg; titer 7×10^12 vg/mL) was unilaterally injected at a rate or 2 nL/sec into the mPFC (100 nL in IL ...
-
bioRxiv - Systems Biology 2021Quote: RTK constructs were obtained from three sources: 7 were gifts from William Hahn & David Root (Addgene plasmid # 23914 ...
-
bioRxiv - Cell Biology 2021Quote: ... The following expression constructs were a kind gift from Michael Davidson: eGFP-actin-7 (Addgene #56421), mEmerald-actin-N-10 (Addgene #53979) ...
-
bioRxiv - Neuroscience 2020Quote: ... we intracranially injected 200 nL of AAV5-hSyn-DIO-hM3D(Gq)- mCherry (Addgene, titer: 7 × 1012) into both the left and right BLA at coordinates AP ...
-
bioRxiv - Neuroscience 2024Quote: ... RLAs received AAV5-hSyn-DOI-hM4D(Gi)-mCherry (7×10¹²vg/mL, Addgene, plasmid number 44362). As a control ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV-hSyn-DIO-hM4D(Gi)-mCherry (400 nl at titer 7×1012, Addgene, #44362-AAV5) for inhibition ...
-
bioRxiv - Neuroscience 2023Quote: Anterograde transsynaptic expression was done with AAV1-cre (AAV1.CamKII0.4.Cre.SV40, 7×10¹² vg/mL, Addgene). Retrograde transsynaptic expression was performed with starter vector (AAV-DIO-Ef1a-TVA-FLAG-2A-N2C_G ...
-
bioRxiv - Neuroscience 2024Quote: ... RHAs received AAV5-hSyn-DOI-hM3D(Gq)-mCherry (7×10¹²vg/mL, Addgene, plasmid number 44361). Conversely ...
-
bioRxiv - Neuroscience 2024Quote: ... an anterograde Cre-dependent AAV5-hSyn-DOI-hM4Di-mCherry (7×10¹² vg/mL, plasmid #44362, Addgene) for RLA rats (hM4Di-group ...
-
bioRxiv - Neuroscience 2024Quote: ... or an anterograde Cre-dependent AAV5-hSyn-DOI-mCherry (7×10¹² vg/mL, plasmid #50459, Addgene) for control groups (mCherry control groups ...
-
bioRxiv - Immunology 2024Quote: ... HEK293T cells were transfected with the lentiviral vector pScalps-EGFP-Cre recombinase (7) (Addgene plasmid 207132) together with the packaging vectors psPAX2 and pMD2.G (Addgene plasmids 12260 and 12259 by Didier Trono ...
-
bioRxiv - Microbiology 2022Quote: Plasmids used in this study include mEmerald-Mito-7 (a gift from Dr. Michael Davidson (Addgene plasmid # 54160 ...
-
bioRxiv - Neuroscience 2022Quote: [7] GCaMP6s from pGP-CMV-GCaMP6s (a gift from Douglas Kim & GENIE Project, Addgene ID # 40753) (Chen et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... primers 1033F-1038F were individually mixed with primer 1039R and pLdCH plasmid DNA (Addgene #84291, (7)) to amplify an sgRNA expression cassette ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... TG+ controls received identical bilateral infusions of AAV5-hSyn-DIO-mCherry (7×1012 vg / mL; Addgene) and TG-controls received sterile saline.
-
bioRxiv - Neuroscience 2023Quote: ... The virus carried either a red calcium indicator alone (7 mice; jRGECO1a; AAV1.Syn.NES.jRGECO1a.WPRE.SV40; a gift from Douglas Kim & GENIE Project (Addgene plasmid # 100854 ...
-
bioRxiv - Neuroscience 2023Quote: ... we injected a Cre-dependent AAV (AAV5-syn-FLEX-jGCaMP7f-WPRE (Addgene: 7×1012 vg/ml)) in the zona incerta of Vgat-cre mice (Jax 028862 ...
-
bioRxiv - Neuroscience 2024Quote: ... DV: -1.75) and 0.2μl of AAV1-hSyn-axon-GCamP6s (111262-AAV1, Addgene, 7×10¹² vg/mL) was injected at a rate of 0.05μl/min ...
-
bioRxiv - Neuroscience 2024Quote: ... and AAVretrograde-jRGECO1a (7×1012) (pAAV.Syn.NES-jRGECO1a.WPRE.SV40 was a gift from Douglas Kim & GENIE Project (Addgene viral prep # 100854-AAVrg ...
-
bioRxiv - Neuroscience 2024Quote: ... we injected a Cre-dependent AAV (AAV5-syn-FLEX-jGCaMP7f-WPRE (Addgene: 7×1012 vg/ml)) in the NAc of Vgat-cre mice (Jax 028862 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tet-pLKO-puro (gift from D. Wiederschain, Addgene plasmid # 21915) was digested with AgeI and EcoRI and isolated by gel purification (QIAEX II Gel Extraction Kit ...
-
bioRxiv - Neuroscience 2021Quote: ... vector eGFP-pWPT (Addgene #12255, kind gift from D. Trono) was used to express eGFP ...
-
bioRxiv - Cancer Biology 2023Quote: ... packaging with psPAX2 (gift of D. Trono; Addgene plasmid #12260) and pseudo typed with pMD2.G (gift of D ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.8 µg psPAX2 (a gift from D. Trono, Addgene #12260), and 0.7 µg pMD2.G (a gift from D ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene #104964), pAAV2/6 (Addgene #110660) ...
-
bioRxiv - Microbiology 2021Quote: ... the open reading frame was amplified by PCR from the pDONR223 SARS-CoV-2 NSP5 plasmid (Addgene, #141259, a gift from Fritz Roth [32]), including an ATG start codon in the forward primer and a TAA stop codon in the reverse primer (MPro_Fw ...
-
bioRxiv - Immunology 2020Quote: ... pcDNA3-sACE2(WT)-Fc(IgG1) and pcDNA3-SARS-CoV-2-S-RBD-sfGFP plasmids were gifts from Erik Procko (Addgene plasmids #145163 and #141184). pGBW-m4134096 encoding for SARS-CoV-2 M protein was a gift from Ginkgo Bioworks (Addgene plasmid #152039).
-
bioRxiv - Neuroscience 2023Quote: ... Michael Ward and the 2 CLYBL targeting TALEN plasmids (pZT-C13-R1 and pZT-C13-L1, gifts from Jizhong Zou Addgene.org: #52638 and 52637, respectively) by the same method with the Neon Transfection System (40) ...
-
bioRxiv - Neuroscience 2023Quote: Foreskin fibroblasts were transfected with the AAVS1-DOX-KRAB-dCAS9 plasmid and the 2 AAVS1 Talen plasmids (Gifts from Danwei Huangfu, Addgene plasmid # 59025 and 59026) using the Neon Transfection system (38) ...
-
bioRxiv - Cell Biology 2024Quote: ... The FAP-tagging plasmids and those expressing these FAP-tagged cellular markers are all available on Addgene (see Supplemental Table 2 or Addgene global deposit number 84326). Plasmids were transformed into yeast cells using the lithium acetate method (Ausubel ...
-
bioRxiv - Neuroscience 2021Quote: ... were performed over a 5 min period with 1 µL of AAV9-hSyn-Cre (Titer ≥ 1×10¹³ vg/mL, Addgene, Cat. No. 105553-AAV9) or un-injected ...
-
bioRxiv - Molecular Biology 2023Quote: Constructs for shRNA targeting Primpol (5’- ATTTAGCCGACACCTAATATT) Smarcal1 (5’- CTGATTCAAGAGAAGATTAAA) and Smug1 (5’- AACTATGTGACTCGCTACT) were designed and inserted into pLKO.1neo plasmid (Addgene #13425). Lentiviruses were generated using a standard protocol (Feng and Jasin ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4 μg of PHGDH plasmid or 4 μg of empty vector plasmid (Addgene, plasmid #52107) was mixed with 4 μg of DNA RV helper plasmid (Addgene ...