Labshake search
Citations for Addgene :
1601 - 1650 of 2249 citations for Dengue Virus NS1 Protein Serotypes 1 4 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... The open reading freame (ORF) of EGFP was amplified from pEGFP-C2 (#6083-1, Addgene) using upstream and downstream primers located at the BstbI and XbaI cleavage sites ...
-
bioRxiv - Cell Biology 2023Quote: The expression vector of talin 1-RFP was a gift from Michael Davidson (Addgene #55139). FL TSM and HP35st TSM were gifts from Carsten Grashoff (Addgene plasmids #101170 and #101251) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1000k pelleted hiPSCs were mixed with 1 μL 10 μM SP-dCas9-VPR (Addgene, 63798), 9 μL Buffer R2 (STEMCELL Technologies ...
-
bioRxiv - Plant Biology 2023Quote: ... These level 0 parts were assembled into the level 1 Loop acceptor (pCk2; Addgene #136696) in a one-step restriction-ligation reactions with a double CaMV35s-ΩTMV promoter/5′ UTR (pICH51288 ...
-
bioRxiv - Molecular Biology 2023Quote: ... an shRNA targeting human UNK gene was cloned in the pLKO.1 puro plasmid (Addgene_8453) between AgeI and EcoRI sites61 ...
-
ER mediates spatial regulation of lysosome-endosome interactions via motion switch at junction sitesbioRxiv - Cell Biology 2023Quote: ... The shRNA plasmids were constructed based on the lentiviral backbone PLKO.1 (Addgene Cat# 8453) following the protocol provided by Addgene (https://www.addgene.org/protocols/) ...
-
bioRxiv - Developmental Biology 2023Quote: ... ASEC-1 cells were transfected with a Cas9 plasmid carrying puromycin resistance (Addgene pSpCas9(BB)-2A-Puro (PX459 ...
-
bioRxiv - Microbiology 2023Quote: ... Each well was then transfected with the lentiviral packaging vectors psPAX2 (1 µg, Addgene, 12260), and pMD2.G (1 µg ...
-
bioRxiv - Immunology 2023Quote: ... stably expressing clonal RAW MΦs were transduced with pLenti CMV Puro DEST (Addgene w118-1) constructs containing 3xFL-GFP ...
-
bioRxiv - Biochemistry 2023Quote: ... coli BL21 (DE3) cells using the plasmid pRSFDuet-1/CylLL/CylM-2 (Addgene ID #208759), following the method previously reported.9 For the preparation of lanthionine standard ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.25 µL of EnvA G-Deleted Rabies-mCherry (diluted 1:5 in dPBS; Addgene: 32636) was injected in the basal forebrain using the same coordinates ...
-
bioRxiv - Neuroscience 2023Quote: ... and pAAV-syn-FLEX-splitTVA-EGFP- tTA (diluted 1:200 in dPBS; Addgene: 100798-AAV1) was injected into basal forebrain (AP ...
-
bioRxiv - Immunology 2024Quote: Our SAM.1 (PB-UniSAM) parent vector was a gift from Lesley Forrester (Addgene 99866), that itself was a polycistronic derivative of Feng Zhang’s dual vector system (Addgene 61422 ...
-
bioRxiv - Cell Biology 2024Quote: ... Constructs to KD Slug in SGEF KD were cloned into pLKO.1-Hygro (Addgene 24150). To generate Scribble and Dlg1 CRISPR/Cas9 KO cell lines we used pLentiCRISPR v2-Blast (Addgene 83480) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5’-AAACCCTTATTCGTACGTGGCT-3’) foxl2l#1 and foxl2l#2 fragments were cloned into pT7-gRNA (Addgene) through one-step digestion and ligation respectively ...
-
bioRxiv - Neuroscience 2024Quote: ... 1:20 of final mix) was mixed with AAV5-hSyn-DIO-hM3D(Gq)-mCherry (Addgene 44361 ...
-
bioRxiv - Neuroscience 2024Quote: ... at a 1:40 dilution for sparse cell targeting and AAV8-hSyn-dio-GFP (Addgene #50457-AAV8 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Efficient nuclease activity was confirmed using a reporter system (Addgene #67979, #67980; Supp. Fig. 1). We synthesized a custom single guide RNA (sgRNA ...
-
bioRxiv - Biochemistry 2024Quote: ... two all-in-one CRISPR-Cas9 vectors were generated from pX330A-1×2 (58766, Addgene) and pX330S-2-PITCh (63670 ...
-
bioRxiv - Neuroscience 2024Quote: ... we injected a mix of AAV1.Syn.jGCaMP7f (Addgene 104488; dilution 1:10 ∼ 1x1013 GC/mL) and AAV1.Syn.Flex.tdTomato (Addgene 28306 ...
-
bioRxiv - Cancer Biology 2021Quote: The PPARGC1A (PGC1α) gene was amplified from the vector pcDNA myc PGC-1 alpha (Addgene, 10974) using primers containing BamHI and EcoRI cloning sites (PPARGC1A_BamHI_F ...
-
bioRxiv - Cell Biology 2020Quote: ... pGEX6P1-human LIC1 G domain (GST-LIC 1-389) was a gift from Ron Vale (Addgene plasmid # 74598 ...
-
bioRxiv - Neuroscience 2021Quote: ... Constructs injected included: AAV2/1-CAG-FLEx-jGCaMP8 constructs (pGP-AAV-CAG-FLEx-jGCaMP8f-WPRE, Addgene plasmid #162382 ...
-
bioRxiv - Molecular Biology 2020Quote: ... shRNA targeting the C/EBPα and ELF1 were cloned into pLKO.1 vector (Addgene, plasmid # 26655) harboring a blasticidin-selectable marker ...
-
bioRxiv - Genomics 2020Quote: ... the whole cDNA was subcloned into the lentiviral CMV GFP destination vector 736-1 (Addgene #19732), and further used along with packaging vectors to generate lentiviral particles (control lentiviral particles were generated in the same manner using empty lentiviral vectors) ...
-
bioRxiv - Cancer Biology 2019Quote: ... annealed oligos (Supplemental Table 1) were inserted into pSpCas9(BB)–2A–Puro (PX459) V2.0 (Addgene, #62988) using the BbsI (New England Biolabs ...
-
bioRxiv - Immunology 2019Quote: ... Lentiviral vector pBABE-puro-SDF-1 alpha was a gift from Bob Weinberg (Addgene plasmid #12270) 75 ...
-
bioRxiv - Neuroscience 2020Quote: ... the target sequence (5’-GGGTGAAGATCCTGTTCAATA-3’) was shuttled to the pLKO.1-Hygromycin vector (Addgene, #24150). For human astrocytes ...
-
bioRxiv - Bioengineering 2019Quote: ... of a custom GFPACG gBlock cassette (Supplementary Table 1) into AcsI/AgeI-digested SGEN (Addgene #111171) backbone ...
-
bioRxiv - Neuroscience 2021Quote: ... and pAAV5-CaMKII-hChR2(H134R)-eYFP-WPRE (titer ≥ 1×1013 vg/mL, Addgene, Catalog # 26969-AAV5).
-
bioRxiv - Cell Biology 2021Quote: ... pclbw-opa1(isoform 1)-myc (myc-Opa1) was a gift from David Chan (Addgene plasmid # 62845) 47 ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293T cells were transfected with the pLenti-PGK-Tacc3 or pLKO.1 TRC (control, Addgene 10879), pMD2G (Addgene 12259 ...
-
bioRxiv - Biophysics 2020Quote: The DNA of the human kinesin-1 variant devoid of cysteine residue-encoding codons (Addgene #24430) consisted of amino acids 1 to 560 of KIF5B encoding a C-terminal 6xHis-tag[41] ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 µL of the adeno-associated viral vector rAAV9/1.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, #20298-AAV9) was dyed with 0.3 µL fast green (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... and Bach2 ORF (Origene, MR224703 cloned into Addgene, Cat# 52107, 1 μg/ml, marked by GFP) using the X-tremeGENE transfection reagent (Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2020Quote: ... lentivirus destination vector or into the pLenti CMV Puro DEST (w118-1) vector (Addgene Plasmid #17452) using Gateway LR Clonase (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... RRL.sin.cPPT.SFFV/TMPRSS2(variant 1).IRES-neo.WPRE (MT130) was a gift from Caroline Goujon (Addgene plasmid # 145843). pGBW-m4137383 was a gift from Ginkgo Bioworks (Addgene plasmid #149541) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Annealed gRNA oligos were ligated to pLKO.1-puro U6 sgRNA BfuAI stuffer (Addgene plasmid # 50920) or to pLenti SpBsmBI sgRNA Hygro (Addgene plasmid # 62205) ...
-
bioRxiv - Genomics 2022Quote: ... 1-10 µg YAC/BAC payload DNA and 2-5 µg pCAG-iCre plasmid (Addgene #89573) per transfection ...
-
bioRxiv - Molecular Biology 2020Quote: 1×106 cells of WTC p42 were transfected with 5mg AAVS1-TALEN R plasmid (Addgene #59026), 5 μg AAVS1-TALEN L plasmid (Addgene #59025) ...
-
bioRxiv - Genetics 2020Quote: ... digested pENTR-LUC (w158-1; a kind gift from Eric Campeau & Paul Kaufman; Addgene plasmid #17473)(33 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The pLenti CMV rtTA3 Blast (w756-1) was a gift from Eric Campeau (Addgene plasmid #26429).
-
bioRxiv - Cancer Biology 2020Quote: ... was cloned into pINDUCER20 (Meerbrey et al., 2011) and pLenti CMV Blast DEST (706-1) (Addgene plasmid #17451 was a gift from Eric Campeau & Paul Kaufman ...
-
bioRxiv - Neuroscience 2019Quote: ... an AAV1:CBA:FLEX:Arch-GFP vector was used (UPenn [Addgene], cat. no. AV-1-PV2432 [22222-AAV1]). In mice for the control groups (Figs ...
-
bioRxiv - Biochemistry 2021Quote: ... and ASW (Uniprot Q9BVC5-1) were subcloned into the UC Berkeley MacroLab 438B (Addgene plasmid #55219), 438Rgfp (Addgene plasmid #55221) ...
-
bioRxiv - Biochemistry 2021Quote: ... and ASW (Uniprot Q9BVC5-1) were subcloned into the UC Berkeley MacroLab 438A (Addgene plasmid #55218) plasmid along with sequences encoding N-terminal affinity/fluorescence tags ...
-
bioRxiv - Microbiology 2020Quote: ... pLenti CMV Blast DEST (706-1) (a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17451)) constructs carrying a human Plxdc1-TwinStrep or Plxdc2-TwinStrep expression cassette (pLenti-CMV-Blast-Plxdc1-Strep/ pLenti-CMV-Blast-Plxdc2-Strep ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2012) were cloned into the pLKO.1-Puro vector (a gift from R. Weinberg; Addgene #8453) to generate pLKO.1-Cys-TD and pLKO.1-Scr-TD ...
-
bioRxiv - Immunology 2021Quote: ... Guide 1 (TGTTGGGGAACATATGACAC) and Guide 2 (AAGGAAAAATTCAAACAAGG) sequences were cloned into lentiGuide-puro plasmid (Addgene, #52963), transformed in Stbl3 bacteria (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... Major changes to the reported protocol included: 1) Use of a 2nd generation psPAX2 (Addgene, #12260) lentivirus packaging system instead of the 3rd generation system used by the Bloom lab ...