Labshake search
Citations for Addgene :
1601 - 1650 of 1981 citations for Cow Fibrinogen Like Protein 1 FGL1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... a human RNH1-full coding sequence (ORIGEN RC 200082) insert was cloned into the entry vector pENTR4-GFP-C1 (W392-1, Addgene) and then recombined into the destination vector pLenti CMV Blast DEST (706-1 ...
-
bioRxiv - Immunology 2021Quote: RNH1-KO THP1 cells were infected with lentiviruses expressing RNH1 (pLenti CMV Blast GFP-RNH1) or the empty vector pLentiCMV-GFP-Blast (659-1, Addgene) as previously described (Papin et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... to co-transfect pBABE-puro or pBABE-puro.SLX4IP.3xFLAG with pCMV-VSV-G (at a ratio of 6:1, Addgene#8454) into GP2-293 cells (Clontech) ...
-
bioRxiv - Microbiology 2019Quote: ... 2.18 μg of env-defective HIV-1 provirus containing GFP reporter was cotransfected with 0.31 μg pMD2.G VSV G plasmid (Addgene #12259). Simian immunodeficiency virus (SIV)−VLPs containing Vpx were produced by the transfection of 2.18 μg pSIV−Δpsi/Δenv/ΔVif/ΔVpr (Addgene #132928 ...
-
bioRxiv - Bioengineering 2022Quote: ... sgRNA cassette) were PCR-amplified and recloned into 2 lentiviral plasmids (pLKO.1 neo, Addgene #13425; pLJM-EGFP, Addgene #19319) and ...
-
bioRxiv - Cell Biology 2022Quote: ... U2OS 2-6-3 were transduced with pLenti CMV rtTA3 Blast (w756-1, plasmid #26429; Addgene, gift from E. Campeau) for the expression of rtTA ...
-
bioRxiv - Immunology 2019Quote: ... pMul1-FLAG and pAsc-Myc were subcloned into pLenti X2 Hygro DEST (a gift from Eric Campeau and Paul Kaufman, w17-1, #17295, Addgene) and transfected into HEK293T cells together with the helper plasmid (psPAX2 ...
-
bioRxiv - Microbiology 2019Quote: ... and cloned into EcoRV-cut pLenti CMV Puro DEST (w118-1) (gift from Eric Campeau & Paul Kaufman; Addgene plasmid # 17452) using NEBuilder® HiFi DNA Assembly Master Mix (New England BioLabs) ...
-
bioRxiv - Synthetic Biology 2019Quote: We first obtained the yeast strain containing the reporter gene by integrating (lexA-box)x-PminCYC1-Citrine-TCYC1 plasmids (x = 4, 2 or 1) (Addgene plasmids #58434 ...
-
bioRxiv - Neuroscience 2020Quote: ... injections of rAAV2-retro-Cre (produced by Salk Vector Core or Vigene, 2×1012 to 1×1013 viral genomes/ml, produced with capsid from Addgene plasmid #81070 packaging pAAV-EF1a-Cre from Addgene plasmid #55636 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... to specifically target TP53 translation stop site and it was cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9-hGem (1/110) (Addgene #71707) according to the protocol of Ran et al.51 ...
-
bioRxiv - Neuroscience 2020Quote: ... Whole-cell patch-clamp recordings were also performed for functional evaluation of Cl− microdomains (Figure 1) on organotypic slices of DLX-Cre mice which were transfected on the day of slicing with tdTomato virus (Addgene-AAV9-CAG-FLEX-tdTomato ...
-
bioRxiv - Biochemistry 2020Quote: ... H-HCF-1) and full length human THAP11 cDNA with carboxy-terminal FLAG tag (Plasmid #28020; F-THAP11) were obtained from Addgene. Vectors containing full length human THAP1 cDNA with carboxy-terminal 1X FLAG tag (THAP1-F ...
-
bioRxiv - Biophysics 2020Quote: ... as per the manufacturer’s instructions into pLenti CMV Hygro DEST (W117-1, a gift from Dr. Eric Campeau & Dr. Paul Kaufman, Addgene #17454) to create the final vector which was sequence verified by Sanger sequencing (Australian Genome Research Facility) ...
-
bioRxiv - Cancer Biology 2020Quote: ... we designed single guide RNAs specifically targeting exon 1 of the mouse Bmal1 gene and subcloned it into the PX459 vector (Addgene) to obtain the PX459-Bmal1 plasmid ...
-
bioRxiv - Cancer Biology 2019Quote: ... was prepared by introducing four silent mutations into the sequence targeted by shNRF2 #1 in pEN_TT 3xFLAG-NRF2 (Addgene #136527). Site-directed mutagenesis was performed with the QuikChange II XL kit (Agilent).
-
bioRxiv - Cell Biology 2021Quote: ... NANOG and PRDM14 (see Table 1) were cloned into pLentiCRISPR V2 vectors with puro (SOX2, NANOG) or hygromycin B (PRDM14) resistance (Addgene plasmids #52961 and #98291 respectively ...
-
bioRxiv - Cell Biology 2021Quote: ... gonads of young adult BOX428 animals were microinjected with 30 ng/μl Pelt-2::αGFP-NB::ZIF-1 and 2.5 ng/μl Pmyo-2::GFP (#Addgene 26347) as a co-injection marker ...
-
bioRxiv - Cell Biology 2021Quote: ... and pLKO.1 puro-based plasmid harboring the designed shRNA (pCMV-VSV-G and pLKO.1 puro were a gift from Bob Weinberg, Addgene plasmid #8454 ...
-
bioRxiv - Neuroscience 2020Quote: PV-Cre and SST-Cre slices were transfected in three different configurations: 1) 2.2 μL of ChETA (pAAV9-Ef1a-DIO-ChETA-EYFP Addgene#: 26968) and 1 μL of LSL-tdTomato (Addgene# ...
-
bioRxiv - Microbiology 2021Quote: Individual sgRNAs (sgLRRC15 #1: GACATGCAGGCACTGCACTG; sgLRRC15 #2: AGTGTCAGCCCGGGACATGC; sgACE2: GTTACATATCTGTCCTCTCC) targeting the candidate genes were cloned into linearized pXPR_502 (Addgene, #96923) for CRISPR activation ...
-
bioRxiv - Molecular Biology 2020Quote: A pET28a vector with sub-cloned cDNA of Hsp53-(1-73) (72R) and the N-terminal His-tag was procured from Addgene, (plasmid #62082) ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of pEA216-1 was then co-transfected with 5 μg of the pCMVΔR8.2 helper plasmid (Addgene Plasmid #122263) and 1 μg of pHEF-VSV-G into 70% confluent monolayers of 293T cells in a 10 cm dish using polyethylenimine (Polysciences Inc ...
-
bioRxiv - Bioengineering 2020Quote: ... 400,000 HEK cells were seeded in 6-well plates and the next day transfected with 1 μg psPAX2 (Addgene #12260), 3 μg pCMV-VSV.G (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: Huwe1 stable knockdown: The same targeting sequences as for siRNA studies were cloned to pLKO.1 puro plasmid (Addgene 8453). As control ...
-
bioRxiv - Cancer Biology 2021Quote: ... Luciferase was introduced into pediatric brain tumor cell lines using lentiviral plasmids: pLenti CMV Puro LUC (w168-1) was a gift from Eric Campeau & Paul Kaufman(45) (Addgene plasmid # 17477 ...
-
bioRxiv - Cell Biology 2022Quote: ... RPE-1 TUB-mRFP cells were generated in our lab by transduction with lentiviral vectors containing tubulin m-RFP (Addgene). HEK293T cells at a 50-70% confluence were co-transfected with lentiviral packaging vectors (16.6 μg of Pax2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were transfected with a 6:1 ratio of a firefly luciferase reporter plasmid driven by a pGL3-RARE-responsive promoter (Addgene) and a Renilla luciferase reporter plasmid driven by a constitutive CMV promoter (Promega) ...
-
bioRxiv - Cell Biology 2022Quote: ... organoid fragments were washed and resuspended in Opti-MEM supplemented with Y-27632 (10 µM) and 10µg of pSPgRNA plasmid together with the frame selector plasmid pCAS9-mCherry-Frame +1 (Addgene #66940) and the mNEON targeting plasmid (a kind gift from V ...
-
bioRxiv - Microbiology 2022Quote: Retrovirus particles for transduction and stable cell generation were produced in HNE-1 cells following JetPrime transfection of expression plasmids (pBabe neo, pBabe-HA-LMP1 neo) and packaging plasmids pMD2.G (Addgene; number 12259 ...
-
bioRxiv - Cell Biology 2022Quote: ... talin 2 shRNA-stable cells were co-transfected with Tln1 siRNA and EGFP-talin 1 head (Addgene plasmid no. 32856) or EGFP-talin 1 L325R (the mutant version ...
-
bioRxiv - Neuroscience 2021Quote: Other viruses used in the paper: AAV2/1-hSyn-hChR2(H134R)-EYFP was a gift from Karl Deisseroth (Addgene #26973); AAV2/1-hSyn-hM3D(Gq)-mCherry was a gift from Bryan Roth (Addgene #50474) ...
-
bioRxiv - Neuroscience 2020Quote: Full-length Susd4 mouse gene was cloned into the mammalian expression vector pEGFP-N1 (Addgene, Massachusetts, USA, Cat#6085-1) to express a SUSD4-GFP fusion construct under the control of the CMV promoter (pSUSD4-GFP) ...
-
bioRxiv - Cell Biology 2021Quote: ... Exogenous cells - MDCK cells were mosaically transfected using a CMV GFP vector (pLenti CMV GFP Blast (659-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17445 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plasmid 6His-MBP-TEV-huLbCpf1 (plasmid # 90096) (see Figure.1 and Supplementary M3 in the Supplement Data) was purchased from Addgene. After extracted from amplified strains ...
-
bioRxiv - Immunology 2020Quote: ... with lentiviral packaging vectors pCAG-eco and psPAX.2 plus empty pLKO.1 control (EV) with a puromycin selection cassette (all obtained from Addgene) or a shRNA containing pLKO.1 targeting DGAT1 (GE Dharmacon CAT# RMM4534-EG13350 - TRCN0000124791) ...
-
bioRxiv - Cancer Biology 2020Quote: Primary dMMR mouse or human organoids were generated using lentiviral transduction as described previously.25,30 Lentivirus was prepared as previously described using the pLKO.1 system (Addgene #10878) and containing the shRNA sequences in Supplementary Table 1.24 Lentivirus was concentrated 100X by ultracentrifugation ...
-
bioRxiv - Neuroscience 2020Quote: ... The loxP-NeoR-loxP cassette was inserted at the MluI site in the intron between exons 1 and 2 following PCR amplification from pL452 (Addgene) using primers 3-For and 3-Rev ...
-
bioRxiv - Plant Biology 2022Quote: ... The first step involved the cloning of the tobacco sgRNA expression vectors (pYPQ131c, pYPQ132c, and pYPQ133c (Addgene, USA; Table 1) that contained the sgRNAs as inserts ...
-
bioRxiv - Immunology 2022Quote: ... with lentiviral packaging vectors pCAG-eco and psPAX.2 plus empty pLKO.1 control (EV) with a puromycin selection cassette (all obtained from Addgene) or a shRNA containing pLKO.1 targeting Cpt1a (GE Dharmacon CAT# RMM3981-201819967 – TRCN0000110596 ...
-
bioRxiv - Cell Biology 2022Quote: ... was constructed by recombining pENTR1a emGFP-Slc37a2 iso 2 with the pLenti PGK Hygro DEST (w530-1) vector (a gift from Eric Campeau and Paul Kaufman, Addgene plasmid # 19066 ...
-
bioRxiv - Immunology 2022Quote: ... annealed oligos were diluted 1:20 in molecular grade H2O and then ligated into Esp3I-digested pLentiCRISPR V2.0 (Addgene #52961). Ligation reactions were then transformed into Top10 competent E ...
-
bioRxiv - Cancer Biology 2019Quote: ... the HFF-1 cells were lentivirally transduced with GFP-H2B nuclear marker using the PGK-H2BeGFP system as described by Addgene and selected by flow sorting for GFP positive cells.
-
bioRxiv - Cell Biology 2019Quote: ... Annealed oligos were diluted 1/40 and 1 μl of insert was ligated into 10 ng of digested vector (pU6-sgRNA EF1Alpha-puro-T2A-BFP, Addgene plasmid #60955 digested with BstXI and Blpl ...
-
bioRxiv - Cell Biology 2019Quote: ... IRES DNA and mCherry cDNA were prepared by PCR using pEYFP SUMO-1 plasmid (from Mary Dasso: Addgene plasmid #13380), pWPI plasmid (from Didier Trono ...
-
bioRxiv - Microbiology 2020Quote: ... or human ACE2 ectodomain (containing a C-terminal His tag) were made according to the E and F sections of the pLKO.1 Protocol from Addgene (http://www.addgene.org/protocols/plko/) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and plasmids were obtained from Open Biosystems or cloned using pLKO.1-TRC (a gift from Dr. David Root (Addgene # 10878; http://n2t.net/addgene:10878; RRID: Addgene 10878)) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and plasmids were obtained from Open Biosystems or cloned using pLKO.1-TRC (a gift from Dr. David Root (Addgene # 10878 ...
-
bioRxiv - Neuroscience 2021Quote: ... mDlx-Azurite was generated by replacing EGFP with Azurite from the pAAV-mDlx-GFP-Fishell-1 plasmid (Addgene number: 83900). Generation of pORANGE Btbd11 constructs were generated using the pORANGE Cloning template vector (Addgene number ...
-
bioRxiv - Molecular Biology 2020Quote: ... The four guide sequences for the Ascl1 locus (see Table 1) were taken from (Black et al., 2016) and cloned into pmU6-gRNA (Addgene: 53187 ...