Labshake search
Citations for Addgene :
1601 - 1650 of 2201 citations for 7 16 DIHYDROBENZO A BENZO 5 6 QUINO 3 2 I ACRIDINE 9 18 DIONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: Fusion constructs with pTREtight2 vectors were co-transfected with reverse tetracycline-controlled transactivator 3 (pLenti CMV rtTA3 Hygro (w785-1)) plasmid (Addgene) in the presence of doxycycline (Clontech) ...
-
bioRxiv - Neuroscience 2023Quote: ... we inserted a barcode sequence consisting of 20 random nucleotides in the 3’ untranslated region of the nucleoprotein gene in pRVΔG-4mCherry (Addgene #52488) (SAD B19 strain ...
-
bioRxiv - Cell Biology 2023Quote: ... The RNAi clone that targets the 3’UTR of CDC-42 was generated through amplification of genomic CDC-42 3’UTR (Fwd: gaagatctgaacgtcttccttgtctccatgt; Rev: ggggtaccacgtaacggtgtatccggac) and insertion into the L4440 plasmid (#1654 Addgene). Control bacteria is transformed with empty L4440 vector (#1654 Addgene).
-
bioRxiv - Genetics 2023Quote: ... 1 × 106 iPS cells were seeded at a density of 100,000 cells/cm2 and transfected with 3 μg pC13N-dCas9-BFP-KRAB (Addgene, 127968), 0.375 μg pZT-C13-L1 (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... the ReaChR virus was co-injected unilaterally into the LC with AAV9-hSyn-FLEX-jGCaMP8m (3 × 1013 gc/mL, 162378-AAV9 from Addgene) or with AAV9-hSyn-GRABNEm (2-9 × 1013 gc/mL ...
-
bioRxiv - Genomics 2024Quote: ... and the top 3 sgRNAs were individually cloned into single sgRNA expression vectors with direct capture cs1 sequences (Addgene # 122238)10 using restriction digest (BstXI and BlpI ...
-
bioRxiv - Molecular Biology 2023Quote: ... The sequence of a single guide RNA (sgRNA) specifically targeting the 3’ end of TGRH88_003980_t1 was integrated into pSAG1::CAS9-GFPU6::sgUPRT (Addgene plasmid # 54467) using the Q5-site directed mutagenesis kit (NEB) ...
-
bioRxiv - Developmental Biology 2024Quote: ... MegaGate was utilized to insert ORFs into the final PB-cT2G-cERP2 3’ UTR barcode-modified expression vectors (Addgene 175503). Three unique barcodes were selected for each ORF with an average hamming distance of six ...
-
bioRxiv - Cell Biology 2024Quote: ... a gift from Zuoshang Xu)63 and cloned in frame with the N-terminal 6- His-SUMO-TEV-site into the SspI site of pET 6His-SUMO-TEV LIC (1S) (Addgene 29659, a gift from Scott Gradia) using the HiFi Assembly kit (NEB) ...
-
bioRxiv - Cell Biology 2022Quote: ... A Rac1 specific gRNA 5’ ACACTTGATGGCCTGCATCA was cloned into plasmid pX330-BbsI-PITCh (Addgene plasmid #127875) and transfected along with pN-PITCh-GFP-Rac1 into HeLa cells using JetPrime (Polyplus ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA encoding TNKS ARC1-5 (aa 174-985) was subcloned by PCR into pFLAG-CMV2 (Addgene.org). All vectors subcloned using PCR were sequenced on both strands for verification.
-
bioRxiv - Cell Biology 2021Quote: ... antisense: 5’-aaacTACGCATTGGACGGCTCCTCc) was cloned into pSpCas9 (BB)-2A-mCherry created by PX459 V2.0 (Addgene #62988). This plasmid was then transfected into immortalized STING-knockout MEFs (Mukai et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... SKOR1-shRes-WT and -Y234F were then recombined into pLenti CMV-GFP (658-5) (Addgene; 17448). For transduction of the above mentioned constructs ...
-
bioRxiv - Neuroscience 2022Quote: ... [14] and low-titer Cre (AAV9-hSyn-Cre-WPRE-hGH; Addgene #105553, MOI = 5×103 vg) AAVs on DIV 7 ...
-
bioRxiv - Cancer Biology 2019Quote: ... HCT116-Dnmt1Δ3-5 cells were transfected with pcDNA3 vector containing WT full length DNMT1 (36939, AddGene) and empty pcDNA3 vector as a transfection control (10792 ...
-
bioRxiv - Cell Biology 2020Quote: ... Blunt-end repaired RhoBAST16 was cloned into 5′ UTR CGG 99× FMR1-EGFP (Addgene, plasmid #63091) which was digested with the NotI enzyme ...
-
bioRxiv - Molecular Biology 2021Quote: ... an XhoI restriction site was generated 5’ of the GFP-gene in pDRGFP (Addgene plasmid #26475)23 and the GFP-gene was replaced by the eBFP1.2 gene using the XhoI/NotI restriction sites ...
-
bioRxiv - Neuroscience 2022Quote: ... mice were infused with diluted (1:5) or undiluted virus pAAV5-CAMKIIa-(hChR2- H134R)-eYFP (Addgene-ChR2 titre ...
-
bioRxiv - Physiology 2022Quote: ... The control virus AAV2/5-hSyn-DIOmCherry was ordered from Penn Vector Core (Addgene plasmid 50459). Animals were allowed to recover from stereotaxic surgery for a minimum of 21 days before initiation of any experiments ...
-
bioRxiv - Molecular Biology 2023Quote: ... and guide cassettes were assembled into pGGG-M along with end linker pELE-5 (Addgene #48020). The resulting plasmid was named pGGG-TaDMC1-D and sequenced to ensure authenticity before transferring to Agrobacterium.
-
bioRxiv - Cancer Biology 2023Quote: The sgRNAs specific for 5’ to the region of interest were cloned in pLentiCRISPRv2 (Addgene, #52961). sgRNAs corresponding to 3’ to the region of interest was cloned in pDecko-mCherry (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... or eYFP alone as a control (AAV-EF1a-DIO-eYFP; serotype 5; Dr. Karl Deisseroth; RRID:Addgene_27056).
-
bioRxiv - Molecular Biology 2023Quote: ... Three clones with the correct insertion were transiently transfected with either 5 μg pFlpO (Addgene #13793) to remove the neomycin selection cassette or both 5 μg pFlpO (Addgene #13792 ...
-
bioRxiv - Neuroscience 2023Quote: ... in VTA of TH-Cre rats (N=5) or simultaneously expressing AAV9-rTH-PI-Cre (AddGene #107788 ...
-
bioRxiv - Neuroscience 2023Quote: ... neurons were transduced with AAV9-Syn (5 x 109 gc per well) encoding jGCaMP8s (AddGene 162374) or CaBLAM (in house prep) ...
-
bioRxiv - Cell Biology 2020Quote: ... the pET30-2-GAPDH plasmids was a gift from David Sabatini (Addgene plasmid # 83910) (Pacold et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... The SARS-CoV-2 S-6P plasmid was a gift from Jason McLellan (Addgene plasmid # 154754 ...
-
bioRxiv - Neuroscience 2021Quote: ... and 2 μg of viral entry protein VSV-G plasmid pMD2.G (Addgene; 12259) were mixed into 600 μl of serum-free DMEM ...
-
bioRxiv - Genomics 2020Quote: ... pCFJ90 - Pmyo-2∷mCherry∷unc-54utr (Addgene plasmid # 19327; http://n2t.net/addgene:19327; RRID:Addgene_19327), pCFJ104 - Pmyo-3∷mCherry∷unc-54 (Addgene plasmid # 19328 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2) EF1α promoter and puro resistance gene were amplified from lentiGuide-Puro (Addgene #52963). 3 ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA of SKAP2WT and SKAP2W336K (see Table 2) was transferred into pLEX_307 (Addgene #41392). For analysis of subcellular localization ...
-
bioRxiv - Microbiology 2021Quote: ... The pCRISPomyces-2 vector used in this study was obtained from Addgene (Code: 617374). All the media and chemicals were used in this study were purchased from Hi-media (Mumbai-India ...
-
bioRxiv - Microbiology 2021Quote: The Plasmid expressing SARS CoV-2 Spike protein (Wuhan isolate) was procured from Addgene with 19 nineteen amino acids deletion at C- terminal that enables efficient lentiviral packaging ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2×106 cells were co-transfected with Cas9 (pU6_CBh-Cas9-T2A-BFP: Addgene #64323) and gRNA (pSPgRNA ...
-
bioRxiv - Neuroscience 2022Quote: ... psiCHECK-2-Sal4-wt_3’UTR was a gift from Robert Blelloch (Addgene plasmid # 31862). psiCHECK-2-Rab GTPases were generated by inserting Rab GTPases into psiCHECK- 2-Sal4-wt_3’UTR by XhoI/NotI.Tetanus toxin light chain (Eisel et al. ...
-
bioRxiv - Microbiology 2022Quote: ... pGBW-m4252984 (SARS-CoV-2 E [envelope]) was a gift from Ginkgo Bioworks (Addgene plasmid #153898 ...
-
bioRxiv - Neuroscience 2022Quote: ... All AAV plasmids presented in this study are available from Addgene (Supplementary Table 2).
-
bioRxiv - Developmental Biology 2021Quote: ... and 8×105 cells were electroporated with 2 μg Cas9-sgRNA plasmid (Addgene: #48139), 1 µg pEGFP-Puro and 200μM (6.6 μg ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 gRNA plasmids were generated per construct and were integrated into pX330 (Addgene# 42230) using BbsI site as previously described 16 ...
-
bioRxiv - Molecular Biology 2019Quote: ... HA-SUMO-2 WT plasmid was a gift from Guy Salvesen (Addgene plasmid # 48967). Flag-PIAS4 WT plasmid was a gift from Ke Shuai (Addgene plasmid # 15208) ...
-
bioRxiv - Neuroscience 2019Quote: ... astrocytes were transfected with 2 μg of pLYS1-FLAG-MitoGFP-HA (Addgene plasmid # 50057) which contains the pore-forming subunit of the mitochondrial calcium uniporter coupled to GFP or a mito-mCherry construct generated by subcloning the targeting sequence of the pLYS1-FLAG-MitoGFP-HA plasmid into the mcherry2-N1 vector (Addgene plasmid # 54517) ...
-
bioRxiv - Immunology 2021Quote: The mammalian expression plasmid containing SARS-CoV-2 HexaPro spike was obtained from Addgene (Addgene plasmid # 154754 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2) the NLS-Cas9 gene from the pHsp70 Cas9 plasmid (Addgene plasmid #46294 (32)) connected to the promoters and 3’-UTRs from the β2tubulin (AAEL019894) ...
-
bioRxiv - Molecular Biology 2022Quote: ... HeLa cells (ATCCCCL-2) were transiently transfected with SpCas9-expressing PX459 plasmid (Addgene # 62988) using Lipofectamine 2000 (ThermoFisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV vectors expressing ChrimsonR (pAAV1-Syn-ChrimsonR-tdT; 2 × 10^13 GC/ml; Addgene) 27 or channelrhodopsin-2 (hChR2 ...
-
bioRxiv - Neuroscience 2022Quote: ... we first cloned 2 single guide RNAs (sgRNAs) into a pCFD5 plasmid (Addgene #73914): sgRNA1 atcgtccggcagccagcgttcgg (189bp upstream of the start codon ...
-
bioRxiv - Microbiology 2023Quote: ... Shedu-ΔNL constructs were cloned into UC Berkeley Macrolab vector 2-BT (Addgene #29666), which encodes an N-terminal TEV protease-cleavable His6 tag.
-
bioRxiv - Molecular Biology 2023Quote: ... two different gRNAs for SETD6 (Table 2) were cloned into lentiCRISPR plasmid (Addgene, #49535). Following transduction and puromycin selection (2.5 µg/ml) ...
-
bioRxiv - Cell Biology 2023Quote: ... elegans cDNA library and cloned into UC Berkeley Macrolab vector 2-CT (Addgene #29706), which encodes a TEV protease-cleavable His6-MBP (maltose binding protein ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding ancestral and variant SARS-CoV-2 spike protein were purchased from Addgene (170442 ...