Labshake search
Citations for Addgene :
1601 - 1650 of 2604 citations for 6H 5 Oxa 1 2a 4a triazacyclopenta cd pentalene 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... in the level 1 vector pICH47802 (Addgene, catalog number: 48007). Level 1 pICH47811-pTCSn::nls:tGFP::tATPase (position 2 ...
-
bioRxiv - Plant Biology 2021Quote: ... in the level 1 vector pICH47811 (Addgene, catalog number: 48008). To amplify IPT3 promoter (gene ID v4 ...
-
bioRxiv - Microbiology 2020Quote: ... pLKO.1-puro-shNT (gift from Jacob Corn, Addgene #109012) was used as a scrambled shRNA control ...
-
bioRxiv - Cell Biology 2021Quote: ... and AdEasier-1 cells (gift from Bert Vogelstein; Addgene, #16399)
-
bioRxiv - Neuroscience 2021Quote: ... Animals were injected with saline-diluted AAV2/1.hSyn.GCaMP6f.WPRE.SV40 (Addgene) at a depth of 250 and 550 µm (final concentration ...
-
bioRxiv - Cancer Biology 2019Quote: ... followed by pLenti-CMV-Puro DEST vector (Addgene, w118-1). The plasmids were propagated in DH5α bacterial cells (Life Technologies) ...
-
bioRxiv - Biophysics 2019Quote: ... human α-actinin 1 cDNA (Addgene; pEGFP-N1 alpha-actin1) was truncated at the actin binding domain (Asp1-Ala247) ...
-
bioRxiv - Cancer Biology 2020Quote: ... pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 8453 ...
-
bioRxiv - Neuroscience 2019Quote: ... and β-arrestin 1-FLAG (#14687) were obtained from Addgene.
-
bioRxiv - Cancer Biology 2019Quote: ... expressed from a pLKO.1-hygro plasmid backbone (Addgene #24150). Three days after lentiviral transduction ...
-
bioRxiv - Cell Biology 2020Quote: ... pLKO.1 constructs were co-transfected with psPAX2 (Addgene 12260) and VsvG (Addgene 8454 ...
-
bioRxiv - Biochemistry 2021Quote: ... Nb_EfrCD#1 was cloned into expression plasmid pBXNPHM3 (Addgene #110099) using FX cloning and expressed as described previously [42] ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV.1.hSyn.dio.EGFP (anterograde labelling, 140 nl, Addgene, no. 50457); retrograde.AAV.hSyn1.chI.mCherry.2A.iCre.WPRE.SV40p (retrograde labelling of LHb inputs and whole-brain clearing ...
-
bioRxiv - Neuroscience 2022Quote: ... titer: 5.0 × 1012 GC/ml (Cat # AV-1-ALL854, RRID:Addgene_51502 ...
-
bioRxiv - Neuroscience 2022Quote: AAV2/1 hSyn-DIO-stGtACR2-FusionRed (Addgene, 4.2E13 GC/ml)
-
bioRxiv - Neuroscience 2022Quote: ... to inject 1 μl pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40 (Addgene, catalog # 105551-AAV9) or 1 μl pENN.AAV.CamKII0.4.eGFP.WPRE.rBG (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... The following AAVs were injected: 1) AAV1.hSyn.cre.WPRE.hGh (Addgene #105553) at one of three doses (1.73×1012 ...
-
bioRxiv - Immunology 2022Quote: ... et al 16 were purchased from Addgene (Supplemental Table 1), and used to make stable expression cell lines in HEK293 cells by lentiviral transduction ...
-
bioRxiv - Neuroscience 2022Quote: ... Viral injections of 1 μl hSyn.iGluSnFr.WPRE.SV40 (Addgene, plasmid #98929-AAV1) for glutamate imaging or 1 μl pENN.AAV.CamKII.GCaMP6f.WPRE (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... the IMS using SMAC (residues 1-59, from Addgene 136469), the IBM using IMMT (residues 1-18734) ...
-
bioRxiv - Molecular Biology 2023Quote: ... in the Level 1 acceptor plasmids pL1P3-TaU6 (Addgene #165599) and pL1P4-TaU6 (Addgene #165600) ...
-
bioRxiv - Biochemistry 2023Quote: ... was mixed with packaging plasmids MD2G (1 μg, Addgene 12,259) and PSPAX2 (1 μg ...
-
bioRxiv - Developmental Biology 2023Quote: ... pBS-KS-attB2-SA(1)-T2A-GAL4DBD-Hsp70 (Addgene #62903), pBS-KS-attB2-SA(2)-T2A-GAL4DBD-Hsp70 (Addgene #62904) ...
-
bioRxiv - Developmental Biology 2023Quote: ... pBS-KS-attB2-SA(1)-T2A-VP16AD-Hsp70 (Addgene #62908), and pBS-KS-attB2-SA(2)-T2A-p65AD-Hsp70 (Addgene #62915) ...
-
bioRxiv - Neuroscience 2023Quote: ... DJ-1 (a gift from Mark Cookson, Addgene plasmid 29347), synapto-iATPSnFR2-miRFP670nano3 ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAVrg.Syn.jGCaMP7b.WPRE (Addgene, lot. no. v63074, titer 1 x 1013). For GCaMP expression in the DRG neurons ...
-
bioRxiv - Neuroscience 2023Quote: ... 1.0 µL of pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (diluted 1:2 in dPBS; Addgene: 100845-AAV5 ...
-
bioRxiv - Microbiology 2023Quote: pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 8453 ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV9-CaMKIIa-EGFP (titer: 1×10¹³ vg/mL, Addgene) for chemogenetic silencing and viral control ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-Syn-GCaMP6m-RPL10a (1−1013 gc/mL; Addgene #158777) was injected into PM ...
-
bioRxiv - Neuroscience 2024Quote: ... and pAAV2/1 (a gift from James M. Wilson, Addgene plasmid #112862 ...
-
bioRxiv - Neuroscience 2024Quote: ... viral injections of AAV2/1-CAMK1a-gCaMP6f (Addgene #100834-AAV1) were made into the binocular zone ...
-
bioRxiv - Cancer Biology 2024Quote: shRNAs and were cloned into pLko.1-puro (Addgene #8453) linearized with AgeI and EcoRI ...
-
bioRxiv - Cancer Biology 2024Quote: ... or an empty backbone pLKO.1 control (Addgene plasmid #8453) were used to generate virus and infect OVCAR3 cells or ID8 cells ...
-
bioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
bioRxiv - Neuroscience 2022Quote: ... rAAV2-retro-CMV-bGlo-iCre-GFP (made in house; 1.07×1012 GC ml-1; 17) and AAV2-hSyn-DIO-hM4D(Gi)-mCherry (Addgene #44362; 4.6×1012 GC ml-1; 19); chemogenetic non-projection specific inhibition experiments AAV8-hSyn-hM4D(Gi)-mCherry (Addgene #50475 ...
-
bioRxiv - Biophysics 2020Quote: ... containing N-terminal 6-His-WT-p53 (1-303) (Addgene, 24859), was used to express p53 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The following ORF24 fragments: residues 1-201 (ORF24-NTD) (Addgene #138420), residues 1-271 (Addgene #138421) ...
-
bioRxiv - Cell Biology 2020Quote: ... The Toronto human knockout pooled library (TKO) Version 1 (Addgene #1000000069) was a gift from Jason Moffat19.
-
bioRxiv - Developmental Biology 2020Quote: ... A control PLKO.1 vector containing a scrambled shRNA (Addgene 1864) was used as a control ...
-
bioRxiv - Cell Biology 2019Quote: ... PX458 or PX458 containing gRNA and PLKO.1-puro (Addgene, #10878), were co-transfected into MEFs ...
-
bioRxiv - Biochemistry 2019Quote: The pLKO.1-puro empty vector was purchased from Addgene (#8453). A scrambled shRNA control and gene-specific shRNAs were designed through RNAi Central (http://cancan.cshl.edu/RNAi_central/step2.cgi) ...
-
bioRxiv - Neuroscience 2020Quote: ... AAVrg-Ef1α-mCherry-IRES-Cre (Titer ≥ 7×1012 vg.mL−1, Addgene). Cholera Toxin Subunit B (Recombinant) ...
-
bioRxiv - Neuroscience 2020Quote: rAAV5-hSyn-hChR2(H134R)-eYFP (Titer ≥ 7×1012 vg.mL−1, Addgene), rAAV5-hSyn-Jaws-KGC-GFP-ER2 (Titer ≥ 3.8×1012 vg.mL−1 ...
-
bioRxiv - Neuroscience 2020Quote: ... rAAV5-hSyn-hChR2(H134R)-mCherry (Titer ≥ 7×1012 vg.mL−1, Addgene), rAAV5-Ef1α-DIO-hChR2(H134R)-eYFP (Titer ≥ 4.2×1012 vg.mL−1 ...
-
bioRxiv - Neuroscience 2020Quote: ... A pLKO.1-TRC vector (a gift from David Root; Addgene plasmid #10879 ...
-
bioRxiv - Microbiology 2021Quote: ... Expression vectors for SARS-CoV-2 Wuhan-Hu-1 (Addgene, #149539), SARS-CoV-2 B.1.167.2 (Addgene ...
-
KIF24 controls the clustering of supernumerary centrosomes in pancreatic ductal adenocarcinoma cellsbioRxiv - Cell Biology 2022Quote: ... or negative control annealed oligo was inserted into pLKO.1 (Addgene) (Stewart et al ...
-
bioRxiv - Neuroscience 2020Quote: ... pLKO.1-TSC2 was a gift from Do-Hyung Kim (Addgene plasmid # 15478 ...
-
bioRxiv - Neuroscience 2020Quote: ... and ligated into the pLKO.1 vector (Addgene, 8453 or 26655). Overexpression vectors of either lentiviral (N106 or N174 ...