Labshake search
Citations for Addgene :
1601 - 1650 of 2052 citations for 6 Pent 1 enylpyridine 2 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... A pLKO.1-TRC vector (a gift from David Root; Addgene plasmid #10879; http://n2t.net/addgene:10879; RRID:Addgene_10879) [32] was cloned into an expression vector with an mCherry reporter (Addgene plasmid #114199 ...
-
bioRxiv - Neuroscience 2020Quote: Recombinant adeno-associated virus carrying the GCaMP6f gene (AAV2/1:hSyn-GCaMP6f) was obtained from Addgene (100837-AAV1) with titer ≥ 1×1012 ...
-
bioRxiv - Cancer Biology 2021Quote: ... pLenti CMV Puro LUC (w168-1) was a gift from Eric Campeau & Paul Kaufman(45) (Addgene plasmid # 17477; http://n2t.net/addgene:17477; RRID:Addgene_17477) and pLL-EF1a-rFLuc-T2A-GFP-mPGK-Puro (LL410PA-1 ...
-
bioRxiv - Cell Biology 2021Quote: ... but with a pLKO.1-based vector (gift from Elaine Fuchs, Addgene plasmid # 25999; http://n2t.net/addgene:25999; RRID:Addgene_25999). GFP-H2B transduced cells were sorted by the University of Chicago Cytometry and Antibody Technology Core.
-
bioRxiv - Biochemistry 2022Quote: ... which was then used as a donor to transfer mitoLbNOX into pLenti-CMV-Hygro-DEST (w117-1) (Addgene, 17454 a gift from Eric Campeau & Paul Kaufman ...
-
bioRxiv - Cancer Biology 2022Quote: ... or control vectors pGIPZ (Dharmacon) or pLKO.1 (a gift from David Sabatini, Addgene plasmid #1864; http://n2t.net/addgene:1864; RRID:Addgene_1864) were employed for Vangl2-depletion studies ...
-
bioRxiv - Biophysics 2022Quote: ... pLenti-CMV-Puro-DEST (w118-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17452; http://n2t.net/addgene:17452; RRID:Addgene_17452). pLenti CMVTRE3G Puro DEST (w811-1 ...
-
bioRxiv - Cell Biology 2022Quote: ... was constructed by recombining pENTR1a emGFP-Slc37a2 iso 2 with the pLenti PGK Hygro DEST (w530-1) vector (a gift from Eric Campeau and Paul Kaufman, Addgene plasmid # 19066; http://n2t.net/addgene:19066; RRID:Addgene_19066) using Gateway LR Clonase II enzyme mix (Thermo Fisher ...
-
bioRxiv - Cell Biology 2021Quote: ... Exogenous cells - MDCK cells were mosaically transfected using a CMV GFP vector (pLenti CMV GFP Blast (659-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17445; http://n2t.net/addgene:17445 ; RRID:Addgene_17445)) ...
-
bioRxiv - Cancer Biology 2020Quote: AsPC-1 and Panc 08.13 cells were transfected with pDRGFP plasmid (a gift from Maria Jasin; Addgene #26475)(82) ...
-
bioRxiv - Neuroscience 2020Quote: ... pLKO.1-TSC2 was a gift from Do-Hyung Kim (Addgene plasmid # 15478; http://n2t.net/addgene:15478; RRID:Addgene_15478.).
-
bioRxiv - Systems Biology 2022Quote: pSIRV-AP-1-mCherry was a gift from Peter Steinberger (Addgene plasmid # 118095; http://n2t.net/addgene:118095; RRID:Addgene_118095) (Jutz et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... then ligated into the pENTR1A no ccDB (w48-1) vector (a gift from Eric Campeau and Paul Kaufman, Addgene plasmid # 17398; http://n2t.net/addgene:17398; RRID:Addgene_17398) using the Quick LigationTM kit (New England BioLabs ...
-
bioRxiv - Neuroscience 2022Quote: ... the DNA sequence encoding hPMCA2w/b was PCR amplified from pZac2.1-GfaABC1D-mCherry-hPMCA2w/b (a gift from Baljit Khakh (Addgene plasmid # 111568 ; http://n2t.net/addgene:111568 ; RRID:Addgene_111568) with primers designed to incorporate a N-terminal HA tag encoding the amino acids YPYDVPDYA and used to replace mCherry-PMCA2w/b in the same backbone at the 5’ NheI and 3’ XbaI restriction sites using the NEBuilder Hifi DNA assembly kit ...
-
bioRxiv - Cell Biology 2019Quote: ... EGFP-vinculin head (residue 1-258) and the N-terminal fusion of vinculin-T12 were obtained from Addgene (#46270 ...
-
bioRxiv - Molecular Biology 2019Quote: ... the cells were co-transfected with siRNA and 1 µg of plasmid encoding Perceval HR (Addgene ID:49083) at around 50% cell confluency ...
-
bioRxiv - Cancer Biology 2020Quote: ... pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 8453; http://n2t.net/addgene:8453; RRID: Addgene_8453). shRNA sequences used in this study are as follows:
-
bioRxiv - Molecular Biology 2021Quote: The cell cycle reporter vector pCSII-EF-miRFP709-hCdt(1/100) was a kind gift from Vladislav Verkhusha (Addgene plasmid # 80007; http://n2t.net/addgene:80007; RRID:Addgene_80007). Lentivirus carrying this vector was transduced into RAW-G9 cells after which miRFP709-positive cells were sorted to enrich for transduced cells ...
-
Independent representations of reward-predicting cues and reward history in frontal cortical neuronsbioRxiv - Neuroscience 2020Quote: ... The AAV solution (AAV1-hSyn-NES-jRGECO1a, titer ~1 × 1013 GC/ml, the viral solution provided by Addgene, viral prep # 100854-AAV1 ...
-
bioRxiv - Genomics 2021Quote: ... The Dlx promoter sequence was from pAAV-mDlx-GFP-Fishell-1 (Addgene plasmid #83900; http://n2t.net/addgene:83900; RRID:Addgene_83900)(Dimidschstein et al. ...
-
bioRxiv - Cell Biology 2021Quote: Gibson Assembly (Gibson et al., 2009) was performed with three DNA fragments: (1) linearized pPtPBR1 episome backbone (Addgene, Cambridge ...
-
bioRxiv - Plant Biology 2021Quote: ... pENTR4-GFP-C3 (w393-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17397; http://n2t.net/addgene:17397; RRID:Addgene_17397). The pENTR4 plasmids were recombined in Gateway LR reactions with pGWB414 (Nakagawa et al. ...
-
bioRxiv - Developmental Biology 2021Quote: The following constructs were procured for the study: pGEX4T-1 (gift from Fernando Martin- Belmonte; Addgene plasmid #40059); pmCherry-C1 hSlp2-a (gift from Fernando Martin- Belmonte ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were transfected with 1 ug total DNA (0.5 ug PCR product and 0.5 ug AsCpf1_TATV Cas12 [Addgene: 89354]) using Xtreme-GENE 9 following manufacturer instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Linearized pShuttle-CMV plasmids were transformed into the final viral backbone using electrocompetent AdEasier-1 cells (Addgene, #16399). Successful incorporation of pShuttle-CMV construct into AdEasier-1 cells confirmed via digestion with PacI (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: Soluble human ACE2 with an Fc tag was constructed by PCR amplifying ACE2 (residues 1-615) from Addgene plasmid #1786 (a kind gift from Jesse Bloom ...
-
bioRxiv - Biophysics 2022Quote: A plasmid encoding ACE2 residues 1-615 (pcDNA3-sACE2(WT)-8his) was a gift from Erik Procko (Addgene plasmid # 149268 ...
-
bioRxiv - Cell Biology 2022Quote: ... shRNA sequences containing the following target sequences were cloned into the pLKO.1-TRC cloning vector (Addgene, 10878): nontargeting (NT) ...
-
bioRxiv - Cell Biology 2022Quote: ... These oligos were annealed in annealing buffer (10 mM Tris pH 7.5-8.0, 50 mM NaCl, 1 mM EDTA) as recommended by Addgene (https://www.addgene.org/protocols/annealed-oligo-cloning) ...
-
bioRxiv - Genetics 2022Quote: ... The PCR product was cloned via Gibson assembly into AgeI and EcoRI digested pLKO.1 vector (Addgene#8453). Ligated libraries were electroporated into DH5a electrocompetent cells (Invitrogen) ...
-
bioRxiv - Systems Biology 2022Quote: ... The mKO2 insert was derived from pLL3.7m-Clover-Geminin(1-110)-IRES-mKO2-Cdt(30-120) (Addgene, #83841). Lentiviral Parkin expression vector (pLv-CMV-Parkin-A92mKO2) ...
-
bioRxiv - Molecular Biology 2023Quote: ... MEFs cells were infected with a pLKO.1-Puro plasmid encoding a scrambled shRNA sequence (Addgene plasmid #1864). A list of the shRNA sequences is provided in Supplementary Table 2.
-
bioRxiv - Plant Biology 2023Quote: ... The resulting amplicons were assembled in Level 1 acceptors with an AtU626 promoter (pICSL90002, AtU6-26 Addgene#68261). The final construct was assembled by combining the two Level 1 sgRNA cassettes with cassettes for resistance to kanamycin pICSL11024 (Addgene#51144 ...
-
bioRxiv - Microbiology 2022Quote: ... shRNA sequence of p21 (shp21.1:TRCN0000287021, shp21.2:TRCN0000040126) were cloned into lentiviral vector pLKO.1 neo (Addgene#13425) or pLKO.1 mCherry-Puro generated by overlapping PCR using primer pairs (Table S1 ...
-
bioRxiv - Neuroscience 2022Quote: ... chemogenetic non-projection specific inhibition experiments AAV8-hSyn-hM4D(Gi)-mCherry (Addgene #50475; 4.8×1012 GC ml-1). Retrograde rabies tracing25 ...
-
bioRxiv - Neuroscience 2022Quote: ... <1 μL in total; 1013 vg/mL; pAAV/.Syn.NES-jRGECO1a.WPRESV40--AAV9, pGP-AAV-syn-jGCaMP7s-WPRE AAV9, Addgene) were administered into the hemisphere contralateral to the prism implant (+0.75 – 1.25 mm AP ...
-
bioRxiv - Neuroscience 2023Quote: ... or an empty vector (control, AAV5-Ef1a-DIO EYFP at titer ≥ 1×10¹³ vg/mL, Addgene plasmid # 27056) were utilized ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 mM TCEP) and digested with SUMO protease overnight (expressed and purified in-house from Addgene plasmid pCDB30243). The cleaved protein was dialyzed against Buffer D (25 mM HEPES ...
-
bioRxiv - Neuroscience 2023Quote: ... Adeno-associated virus for expressing GcaMP7f or 8f under the synapsin-1 promoter (AAV1-syn-jGCaMP7f-WPRE; Addgene 104488 ...
-
bioRxiv - Cell Biology 2023Quote: ... The pEGFP-N1- hDEK plasmid (DEK WT sequence inserted into eGFP reporter plasmid “peGFP-N1”; Addgene 6085-1) was used as a template for mutagenesis PCR ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 ng of pcDNA3.3-hCas9 plasmid (constructed by inserting the Cas9 fragment released from Addgene #41815 (ref. 119), into the pcDNA3.3 vector ...
-
bioRxiv - Cancer Biology 2023Quote: pLKO-Tet-puro-hRAF1-shRNA-1 was a gift from Ayaz Najafov (Addgene plasmid # 185371; http://n2t.net/addgene:185371; RRID:Addgene_185371), MEK1-GFP was a gift from Rony Seger (Addgene plasmid # 14746 ...
-
bioRxiv - Neuroscience 2023Quote: ... For transfection, 5 µg of DNA (4:3:1 of a transgene, pCMVdR8.74 (packaging plasmid; Addgene, Plasmid #22036) and pMD2.G (envelope plasmid ...
-
bioRxiv - Neuroscience 2023Quote: ... we additionally injected an AAV encoding for jRGECO1a (AAV2/1-Syn-NES-jRGECO1a-WPRE-SV40, Addgene 100854-AAV1) in 3 locations in V1 (roughly the vertices of a 550 μm-wide equilateral triangle centered 3.5 mm posterior and 2.6 mm lateral to Bregma ...
-
bioRxiv - Cell Biology 2023Quote: ... were created via PCR amplification (see primer list) and assembled into a Spe-1 digested pCFJ151 (Addgene #19330) vector using isothermal assembly (Gibson et al. ...
-
bioRxiv - Immunology 2022Quote: shRNAs were designed to target human Galectin-9 mRNA and cloned into the pLKO.1 vector (Addgene #10878). The sense shRNA sequences are CCTGGTGCAGAGCTCAGATTT (shGal-9 #1 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... flanked by 1-kb Nelfe HDR sequences: The insert was obtained from pCRIS-PITCHv2-dTAG-Puro (Addgene 91796) (Nabet et al ...
-
bioRxiv - Genomics 2022Quote: ... The open reading frames of H3 and H4 were cloned in the Dox-inducible expression vector KA0717 (KA0717_pPB-hCMV*1-cHA-IRESVenus was a gift from Hans Schöler, Addgene plasmid #124168 ...
-
bioRxiv - Developmental Biology 2023Quote: ... nls::Cas9::nls (subcloned from Eef1a-1955/- 1>nls::Cas9::nls a gift from Lionel Christiaen, Addgene plasmid # 59987 ;http://n2t.net/addgene:59987 ; RRID:Addgene_59987)52 ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... coding for the large T oncogene SV40 (V40 1: pBSSVD2005 was a gift from David Ron; Addgene plasmid #21826; http://n2t.net/addgene:21826; RRID:Addgene_21826), using LipofectamineTM LTX (Invitrogen #L3000-008 ...