Labshake search
Citations for Addgene :
1551 - 1600 of 2049 citations for Integrin beta 1 binding protein 1 ITGB1BP1 Antibody Biotin since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... a sox10 minimal promoter was PCR amplified from genomic DNA from AB* larvae with primers (Table 1 and 2) containing overlapping nucleotides to sequences on either side of the AgeI site in pENTR-EGFP2 (Addgene #22450), similarly described in (Quillien et al. ...
-
bioRxiv - Cell Biology 2021Quote: The components for each of the individual optogenetic sensors were first assembled in Level 1 destination vectors included in the MoClo Toolkit (Addgene #1000000044) by Golden Gate (GG ...
-
bioRxiv - Biochemistry 2021Quote: Expression cassette comprising of genes encoding PEPCK along with 1 kb of its promoter was cloned into pIB3 vector (cat # 25452, Addgene, USA) and expressed in P ...
-
bioRxiv - Cell Biology 2021Quote: ... Mito-mCh-1×FLAG and Mito-mCh-smFLAG were constructed by ligating 1×FLAG synthesized by overlapping PCR and smFLAG amplified from smFLAG-KDM5B-24×MS2 (Addgene # 81084) with previously built Mito-mCh-1×HA cut by BglII and BamHI through Gibson Assembly.
-
bioRxiv - Cell Biology 2021Quote: ... U2OS cells seeded on 35mm MatTek chambers with 70% confluency were loaded with 1 µg of smFLAG-KDM5B-24×MS2 (Addgene #81084), 0.5 µg of anti-FLAG FB-GFP and 130 ng of purified MCP-HaloTag protein by bead loading (Cialek et al. ...
-
bioRxiv - Cell Biology 2021Quote: A codon-optimised sequence for full-length USP7 (USP7FL) was cloned into pGEX6p-1 using BamHI/NotI restriction sites (Addgene, #63573). Mutations at S18 were introduced using partially overlapping primers with Phusion Flash polymerase (Thermo Fisher Scientific) ...
-
bioRxiv - Systems Biology 2020Quote: ... We then used lentivirus to stably integrate pCMV-DHB-mCherry or pCMV-mCherry-Geminin(1-110)-P2A-mCitrine-Cdt1(30-120) in pLenti-Puro (Addgene: 39481). Cells were screened with puromycin and sorted by FACS to generate monoclonal cell lines.
-
bioRxiv - Genomics 2021Quote: ... Corresponding DNA oligonucleotides with BbsI overhangs (sequences are listed in Suppl. Table 1) were annealed and ligated with pre-digested pSPgRNA plasmid (Addgene, # 47108). HEK293T17 cells (ATCC ...
-
bioRxiv - Neuroscience 2021Quote: Voltron2 and Channelrhodopsin2 were expressed throughout the motor cortex using injections of a mixture of (1) rAAVretro-hSyn-Cre-WPRE (2×109 g.c.; Addgene #105553-AAVrg), (2 ...
-
bioRxiv - Molecular Biology 2022Quote: FLAG-NKX2-1 or FLAG-GFP open reading frame (ORF) was cloned into pLEX_306 (a gift from David Root, Addgene plasmid #41391). Cells stably expressing Cas9 were generated by infection with the lentiCas9-Blast plasmid (Addgene # 52962 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The double strand DNA coding HMGN5 shRNA and STAT3 shRNA were synthesized by Sangon Biotech (Shanghai, China) and cloned into the lentiviral vector pLKO.1-Puro (Addgene, 8453).
-
bioRxiv - Cell Biology 2022Quote: ... a 20bp guide sequence targeting the 5’ end of WNK1 exon 1 was ligated to the BbsI site of PX459 (Addgene #62988). In addition ...
-
bioRxiv - Immunology 2022Quote: Lentiviruses pseudotyped with HIV-1 env were prepared by transfecting the Lenti-X 293T cells with pCMV-dR8.3 Δvpr (Addgene plasmid #8455), pLOX-CW-tdTomato ...
-
Targeted attenuation of elevated histone marks at SNCA alleviates α-synuclein in Parkinson’s diseasebioRxiv - Neuroscience 2020Quote: ... The catalytically active domains of JARID1A enzyme (1-797 amino acids) was amplified from pcDNA3/HA-FLAG-RBP2 plasmid (Addgene #14800), a gift from William Kaelin (Klose et al ...
-
bioRxiv - Biochemistry 2021Quote: ... two double-stranded oligonucleotides targeting exon 2 of human SGTA (guide #1: 5′-CATGACCAGCTCCGGCACGG-3′ and guide #2: 5′- CAGGAACTGGATGATGGCGT-3′) were ligated into the pSpCas9(BB)-2A-puro vector (Addgene #62988) using BbsI sites ...
-
bioRxiv - Microbiology 2021Quote: ... hairpin loop sequence and shRNA sequence were synthesised (IDT technologies) and annealed oligos cloned into pLKO.1 TRC cloning vector (Addgene #10878) using the unique Age1/EcoR1 sites ...
-
bioRxiv - Neuroscience 2020Quote: Plasmid Cry2olig-mCherry-tau 1-441 was prepared by inserting DNA fragment encoding the full length tau into the linearized Cry2olig-mCherry (Addgene 60032) backbone at the C-terminus of mCherry using Gibson assembly® Cloning kit (New England BioLab Int.) ...
-
bioRxiv - Developmental Biology 2020Quote: ... MCP-TagRFPT constructs were assembled by replacing the eGFP fragment of pNosPE_MCP-eGFP using NheI/BamHI with the TagRFPT coding sequence amplified by PCR (supplementary table 1) from TagRFP-T-Rabenosyn-5 (Addgene 37537). MCP-TagRFPT-NLS was generated by insertion of the TagRFPT-NLS coding sequence into pNosPE_MCP-eGFP with NEBuilder® HiFi DNA Assembly Master Mix (primers listed in supplementary table 1).
-
bioRxiv - Molecular Biology 2020Quote: ... The annealed oligos were diluted (1:200) and cloned into pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-Puro (encoding dCas9-KRAB; Addgene # 71236) using a Golden Gate Assembly strategy (containing ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tetracycline-inducible TET-shRB1 and constitutive shRB1 constructs were created by integrating validated siRNA sequences GAAAGGACATGTGAACTTA (63) and GAACGATTATCCATTCAAA (64) targeting human RB1 (shRB1) into TET-pLKO.1-Puro vector (Addgene #21915) and pLKO.1-Puro vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... plasmids were created by integrating validated siRNA sequences CCTGTCAGGAAACTGTATGAT (62) and AATGGCCATCAGAACGGACTT targeting human ESRRG (shESRRG) into pLKO.1-Puro vector (Addgene #8453). Non-specific siRNA sequence AACAGCCACAACGTCTATATC or siRNA sequence CAACAGCCACAACGTCTATAT targeting GFP were used as controls for shRNA ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293T cells were transfected using Fugene HD transfection reagent in a 3:1 reagent : DNA ratio with packaging plasmid 2 µg psPAX2 (a gift from Didier Trono, Addgene, #12260), 1 µg murine ecotropic envelope plasmid pEnv(eco)-IRES-puro (Morita et al ...
-
bioRxiv - Neuroscience 2021Quote: ... Twenty hemizygous ChAT-Cre mice were bilaterally injected with Cre-dependent inhibitory DREADD fused with mCherry reporter AAV8-hsyn-DIO-hM4Di-mCherry (1×1013 VG/ml; Addgene, 44362) or control virus (AAV8-hsyn-DIO-mCherry ...
-
bioRxiv - Cancer Biology 2021Quote: MEFs were seeded in 6-well plates and transfected for 6-8 h with 1 μg of plasmid 4XCLEAR-luciferase reporter (Addgene, 66800) and 0.1 ug of CMV-Renilla Luciferase (Promega ...
-
bioRxiv - Cancer Biology 2022Quote: The human NOTCH 1 intracellular domain (h1NICD) doxycycline-inducible expression plasmid (pLIX-h1NICD) was a gift from Julien Sage (Addgene #91897)11 ...
-
bioRxiv - Immunology 2022Quote: ... Vector psPAX2 containing the untagged coding sequence for HIV-1 gag-pol was a gift from Didier Trono (Addgene plasmid # 12260).
-
bioRxiv - Cell Biology 2022Quote: All shRNA were generated by ligation of oligos into AgeI and EcoRI of pLKO.1 (Addgene plasmid #8453; Addgene, Teddington, UK). Lower case sequences represent the targeted sequences.
-
bioRxiv - Cell Biology 2022Quote: All shRNA were generated by ligation of oligos into AgeI and EcoRI of pLKO.1 (Addgene plasmid #8453; Addgene, Teddington, UK). Lower case sequences represent the targeted sequences.
-
bioRxiv - Cancer Biology 2020Quote: shRNA targeting CDK9 was cloned into pLKO.1 lentiviral vector (Sequence: Forward: CCGGGTTCGACTTCTGCGAGCATGACTCGAGTCATGCTCGCAGAAGTCGAACTTTTG Reverse:AATTCAAAAAGTTCGACTTCTGCGAGCATGACTCGAGTCATGCTCGCAGAA GTCGAC. Luciferase vector was purchased from Addgene (plasmid #17477). Recombinant lentiviral vector and packaging vector (pCMV-dR8.9 and pMD2.G-VSVG ...
-
bioRxiv - Cell Biology 2020Quote: Oligo duplexes containing a single guide (sg)RNA sequence for ACLY (as shown in Figure 1-figure supplement 1A) were inserted into pCas9(BB)-2A-GFP (a gift from Feng Zhang, Addgene #48138) following the published procedures (Ran et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... Nfia/bxlox/lox;Sun1-sGFP and GLASTCreERT2;Sun1-sGFP control mice were intravitreally injected with 1 μl of AAV9-pCAG-Flex-Tdtomato (Addgene #28306) at 1×10¹³ vg/mL and treated with Tamoxifen diet for 3 weeks ...
-
bioRxiv - Cell Biology 2020Quote: The Fucci reporter construct (pLL3.7m-Clover-Geminin(1-110)-IRES-mKO2-Cdt(30-120)) was a gift from Michael Lin (Addgene plasmid #83841)35 ...
-
bioRxiv - Cell Biology 2020Quote: ... A glass capillary with a fine tip containing plasmid solution is inserted into the eye primordium of stage 26-30 embryos to inject 8−5-8 nl doses of 1 µg/µl of pEGFPC1-hVAP-A (Addgene #104447) or pEGFPC1-hVAP-A KD/MD (Addgene #104449 ...
-
bioRxiv - Immunology 2021Quote: ... HEK293T cells were seeded in 6-well plates and the next day transfected with 1 μg psPAX2 packaging plasmid (Addgene 12260), 500 ng pMD2.G VSV-G envelope plasmid (Addgene 12259 ...
-
bioRxiv - Cell Biology 2021Quote: ... A gBlock containing sequence for SNAP-V5 tags was inserted into pLenti CMVTRE3G eGFP Blast (w818-1) (gift of Eric Campenau, Addgene #27568) at the AgeI restriction site using Gibson Assembly to make pLTRE3G-SNAP-V5-eGFP ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 S / HIV-1 pseudotyped viruses were packaged by co-transfecting a lentiviral construct pHIV-Luciferase (Addgene plasmid # 21375), a packaging construct psPAX2 (Addgene plasmid # 12260 ...
-
bioRxiv - Molecular Biology 2021Quote: ... CUG-targeting and non-targeting short hairpin RNAs (shRNAs) matching the corresponding Cas13d spacer sequences were cloned into the pLKO.1 vector (Addgene, #10878) by AgeI and EcoRI digestion and ligation of 5’-phosphorylated DNA duplexes using T4 DNA ligase (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... were amplified using primers containing overhangs with the homology sites for GMAP cloning and inserted into a lentiviral vector (LV 1-5, Addgene, 68411). This lentiviral backbone was a gift from Dr ...
-
bioRxiv - Immunology 2020Quote: ... Selected gRNAs shown in Figure 1 B and C were synthesized by IDT and cloned into eSpCas9(1.1) (a gift from Feng Zhang Addgene plasmid # 71814). The LC donor DNA of HuGL18 was designed as follows from 5′ to 3′ ...
-
bioRxiv - Cell Biology 2020Quote: Lentiviruses were produced by co-transfecting 1 μmol of pLOVE-mEmerald-MCAK or pLOVE-mEmerald-MCAK-mCherry with the packaging plasmids dRT-pMDLg/pRRE (Addgene #60488), pRSV-Rev (Addgene #12253) ...
-
bioRxiv - Cancer Biology 2020Quote: ... shRNA-mediated knockdown of CCL5 and CXCL10 in the dMMR MC38 cells was achieved using the pLKO.1 system (Addgene #10878) and containing the shRNA sequences in Supplementary Table 1.24 Stably knocked down cells were selected with 250 ug/ml hygromycin and knockdown was confirmed by Western blot.
-
bioRxiv - Cancer Biology 2022Quote: ... the shRNA sequences (5′-CTCATTTAGCAGACATCGCAA-3′ (shRNA-1) and 5′-CTTTACTAGGAGACGCCAATA-3′ (shRNA-2) (Zhang et al, 2012b)) were inserted into EZ-Tet-pLKO-Puro vector (Addgene, 85966), respectively ...
-
bioRxiv - Cell Biology 2022Quote: ... listed in Supplementary Table 1) were cloned into the BsmBI restriction site of the Lenti-Cas9-gRNA-TagBFP2 vector (Addgene 124774) and packaged in 293T cells by co-transfection with pMD2.G (Addgene 12259 ...
-
bioRxiv - Neuroscience 2022Quote: ... In earlier experiments AAV1:CBA:FLEX:Arch-eGFP (200nl;5.48x1012 vg/ml; AV-1- PV2432; University of Pennsylvania vector core, Philadelphia, PA, USA, now at Addgene, 22222 - AAV1) was used ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP1-10 plasmid (pHAGE2-EF1a-GFP1-10-IRES-Puro) was generated by cloning GFP1-10 from pcDNA3.1-GFP(1-10) (Addgene Plasmid #70219) into a lentiviral vector that contains EF-1α promoter and Puromycin selection marker ...
-
bioRxiv - Cancer Biology 2022Quote: ... shRNA clones harboring a blasticidin-resistance gene were generated by cloning validated oligonucleotides into the EcoRI/AgeI sites of pLKO.1-Blast (Addgene, #26655). Gene-specific shRNA lentiviral vectors with a pLKO.1 backbone were purchased from Sigma-Aldrich.
-
bioRxiv - Biochemistry 2022Quote: ... expression plasmid was cloned by PCR amplification from full length ScTop2 12URA-B vector followed by insertion into a modified 1-B (Addgene #29653) E ...
-
bioRxiv - Cell Biology 2022Quote: ... were amplified using primers containing overhangs with the homology sites for GMAP cloning and inserted into a lentiviral vector (LV 1-5; Addgene, 68411). IL6-EGFP from pmIL-6promoterEGFP (Addgene 112896) ...
-
bioRxiv - Genetics 2022Quote: ... sgRNA oligos with BbsI sticky ends (IDT, 25nmole standard desalted, Supplementary Table 1) were ligated into the pDG459 plasmid (Addgene 100901) as previously described 45 ...
-
bioRxiv - Neuroscience 2022Quote: ... we cloned the dgn-1 promoter and AcNPV p10 3’UTR into the vector pPD49.26 (from the Andrew Fire plasmid kit, Addgene Kit #1000000001) to generate plasmid pNTC2 ...