Labshake search
Citations for Addgene :
1451 - 1500 of 1581 citations for Rat Insulin Like Growth Factor 1 Receptor IGF1R ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Oertner) or AAV2/1-EF1a-DIO-iChloC-2A-dsRed (5×1013 GC/ml; Addgene plasmid #70762, a gift from T. Margrie). For calcium imaging experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... Site-directed integration into attP sites was achieved by co-injection of an attB-containing vector (400 ng µl-1) and pBS130 (encoding ΦC31 integrase under control of a heat shock promoter (Addgene #26290)60) ...
-
bioRxiv - Molecular Biology 2023Quote: ... containing 10% FBS and 1% penicillin-streptomycin, and equal amounts of plasmids (250 ng of each: luciferase reporter, actin-GAL4 (Addgene #24344), one dCas9-Rb constructs ...
-
bioRxiv - Neuroscience 2023Quote: ... transfection mix for each plasmid was prepared in the following manner: 1 µg of transfer plasmid and 2 µg of second-generation packaging DNA mix containing psPAX (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Cell Biology 2024Quote: Individual single-guide RNAs (sgRNAs) (sgBTN3A2 #1: TGTTCTCTCCCTTGGCGTTGCTCCACTGTA; sgBTN3A2 #3: ATCATGAGAGGCGGCTCCGGGGAGGGTGTATC) targeting the candidate gene were cloned into linearized lentiCRISPRv2 (#52961, Addgene, USA). Lipofectamine™ 3000 transfection reagent in Opti-MEM medium was used to co-transfect HEK293T cells with psPAX2 (#12260 ...
-
bioRxiv - Cancer Biology 2024Quote: ... generated by transduction of MDA-MB-231 (named in short MB-231) with lentiviral vectors carrying pLKO.1 plasmid (Addgene, 8453) cloned with shANP32E-808 (sh sequence ...
-
bioRxiv - Neuroscience 2023Quote: ... To express the calcium indicator GCaMP6s in neuronal cell bodies or long-range projection axons either AAV5-Syn-GCaMP6s or AAV1-Syn-GCaMP6s (1−1013 gc/mL; Addgene #100843) was injected into the relevant brain region ...
-
bioRxiv - Neuroscience 2024Quote: ... we used OT-IRES-Cre pups injected at P0 into the PVN with a Cre-dependent rAAV2/1 vector expressing eOPN3 (pAAV-hSyn1-SIO-eOPN3-mScarlet-WPRE; Addgene #125713).
-
bioRxiv - Cell Biology 2024Quote: ... The HTR8 cells with mir-218 KO were generated by cloning gRNAs that target mir-218-1 and mir-218-2 into a CRISPR/Cas9 vector PX459 (Addgene #62988). The plasmid was verified by sequencing ...
-
bioRxiv - Cancer Biology 2024Quote: ... ALKBH5 shRNA was generated by ligation of oligonucleotides into the AgeI and EcoRI restriction sites of pLKO.1 (Addgene plasmid #8453). Lentiviral-shRNA particles were generated by transfecting HEK 293T cells with 12 μg of pLJM1 vector containing the shRNA ...
-
bioRxiv - Cell Biology 2024Quote: ... control or mir-218-1-overexpressing HTR8 cells were seeded into 12-well plates and were co-transfected with 1 µg/mL of 5X NFκB luciferase reporter (64) (Addgene plasmid #12453) construct and 20 ng/mL of Renilla luciferase vector (Promega ...
-
bioRxiv - Biochemistry 2024Quote: ... pEGFP-C1-tagged plasmids containing the exon 1 of HTT with 23 CAG repeats (GFP-Q23: wild-type HTT. Addgene, #40261) or 74 CAG repeats (GFP-Q74 ...
-
bioRxiv - Cancer Biology 2021Quote: ... A 370 bp fragment of genomic DNA containing miRNA miR-34c was cloned into the Xho I and Mlu I restriction sites of the pLKO.1 vector (Addgene plasmid #52920) to express miR-34c (32) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1-cell stage embryos were injected with a 1 nl mix of approximately 56-60 pg sgRNA and 190 pg cas9 mRNA (Addgene plasmid #47322). Mosaic embryos were raised to adulthood and crossed with Tupel Long fin (TL ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... of a virus driving expression of membrane-targeted mCherry under control of the GFAP promoter (AAV5/GFAP-hM3dq-mCherry, University of Zurich, Figs. 1-5 or AAV5/GfaABC1D-Lck-GFP, Addgene, Fig. 6) in the NAcore (+1.5mm AP ...
-
Rab35 Governs Apicobasal Polarity Through Regulation of Actin Dynamics During Sprouting AngiogenesisbioRxiv - Developmental Biology 2022Quote: ... The destination vector used in this study was pLenti CMV Neo DEST (705-1) (gift from Eric Campeau & Paul Kaufman; Addgene plasmid #17392). Once validated ...
-
bioRxiv - Cancer Biology 2019Quote: ... GDI2 (crGDI2-1 Fw 5’ GCCACCCGAGTCAATGGGGA 3’ and crGDI2-2 Fw 5’ CACTCTCTCCTCCGTACGTA 3’) into a lentiviral CAS9 expressing plasmid (Addgene Plasmid # 49535) using the BSMB1 restriction sites ...
-
bioRxiv - Cell Biology 2019Quote: ... containing the FOXJ1 targeting sgRNA sequence 5’-GGGCCTTCTTGTAAGAGGCC-3’ or the CCDC40 targeting sgRNA sequence 5’-CTCCTCGTTGGCGGCTGCGCAGG-3’ with 1 μg of MBX plasmid (gift from Linzhao Cheng, Addgene plasmid #64122) and 1 μg of homemade donor plasmid pUC19_FOXJ1_mCherry_cNEO for the FOXJ1_mCherry tagging project were mixed with 4 μL of Lipofectamine and left at room temperature for 10 min to form complexes ...
-
bioRxiv - Cancer Biology 2020Quote: ... To generate inducible CRISPR-Cas9 GFPT2 KO cell lines, parental cells (H460, H157, Calu-1) were first infected by pCW-Cas9 plasmid (Addgene plasmid #50661), sorted by puromycin selection ...
-
bioRxiv - Cell Biology 2020Quote: ... and subcloned into pcDNA3.1-MCSBirA(R118G)-HA vector (a gift from Kyle Roux, Addgene plasmid #36047; http://n2t.net/addgene:36047; RRID:Addgene_36047, (Roux et al, 2012)) ...
-
bioRxiv - Cancer Biology 2021Quote: ... KRT14 mouse and Human ShRNA sequence were cloned in the 3rd generation transfer plasmid pLKO.1 TRC cloning vector (Addgene cat # 10878) between unique AgeI and EcoRI restriction sites downstream of the U6 promoter ...
-
bioRxiv - Neuroscience 2020Quote: AAV-SYN-flex-PSAM4-GlyR-IRES-EGFP was a gift from Scott Sternson (Addgene viral prep # 119741-AAV5; http://n2t.net/addgene:119741; RRID:Addgene_119741; >1×1013 vg/ml). Control virus was AAV1-EF1α-DIO-eYFP (>1×1013 vg/ml ...
-
bioRxiv - Neuroscience 2020Quote: ... the promoter was substituted by mDlx enhancer sequence from pAAV-mDlx-GFP-Fishell-1 (a gift from Gordon Fishell, Addgene plasmid # 83900) and cDNA encoding mCherry was further inserted into multicloning site 21 ...
-
bioRxiv - Neuroscience 2020Quote: ... two viruses were injected in the same animal: AAV1-Syn-NES-jRGECO1a-WPRE-SV40 (Addgene; 1 × 1013 GC/mL titer, 294.4 nL) in Cg1/M2 ...
-
bioRxiv - Plant Biology 2021Quote: ... pICH47811-pTCSn::nls:tGFP (position 2) was cloned together with pICH47802-pIPT3::nls:tdTOMATO::t35S (position 1) in the final plant expression vector pAGM4673 (Addgene, catalog number: 48014).
-
bioRxiv - Plant Biology 2021Quote: ... was cloned together with pICH47802-p35S::ER:tdTOM::tNOS selection marker (position 1) in the final plant expression vector pAGM4673 (Addgene, catalog number: 48014). For simultaneous live imaging ...
-
bioRxiv - Neuroscience 2020Quote: The GECI AAV2/1-Syn-FLEX-mRuby2-CSG-P2A-GCaMP6m-WPRE-SV40 (titer: 2.9 x 1013 GC per ml, Addgene accession no. 102816) in combination with the Cre recombinase AAV2/1.CamKII0.4.Cre.SV40 (titer ...
-
bioRxiv - Neuroscience 2020Quote: ... each given at a total volume of 0.8 μl per hemisphere: 1) inhibitory Gi DREADD (AAV5-hSyn-hM4Di-mCherry; UNC Vector Core; n = 5; AAV8-hSyn-hM4Di-mCherry; Addgene; n = 5); excitatory Gq DREADD (AAV8-hSyn-hM3Gq-mCherry ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sgRNA pairs were manually selected from the output list and cloned into the pGECKO backbone (CRISPRi.1: 5’ GTTACTTCCAACGTACCATG 3’, CRISPRi.2: 5’ CCTGTACCCCCATGGTACGT 3’) (Addgene 78534; (68))
-
bioRxiv - Genomics 2021Quote: ... 100 ng of a synthetic gblock encoding the the HS-CRM8-TTRmin module38 upstream of dsRed (Integrated DNA Technologies) and 1 μg of sgOpti (gift from Eric Lander and David Sabatini, Addgene plasmid #85681)39 ...
-
bioRxiv - Cell Biology 2021Quote: ... A control cell line was generated by infecting U2OS cells stably expressing a non-targeting sgRNA (above) with the lentivirus vector pLKO.1-blast-Scramble (Addgene, cat# 26701) expressing a non-targeting shRNA sequence and selected with 15µg/ml blasticidin for 7 days ...
-
bioRxiv - Cell Biology 2020Quote: WT and JMS hiPSCs were transduced with lentiviruses encloding for the non-specific control short-hairpin RNA (shControl; pLKO.1 puro (Addgene ID: 8453)) or the p53 targeting shRNA (shp53 pLKO.1 puro shRNA (Addgene ID ...
-
bioRxiv - Biochemistry 2022Quote: ... and CstF77 (Uniprot Q12996-1) were cloned into ligation-independent cloning (LIC) expression vectors 1B (gift from Scott Gradia, Addgene plasmid #29653), 1M (Addgene plasmid #29656) ...
-
bioRxiv - Neuroscience 2022Quote: ... GAD2-IRES-Cre mice were injected in the ZI with a 5:1 mix of AAV2/5-hSynapsin1-Flex-axon-GCaMP6s (Addgene, #112010-AAV5) and AAV2/9-FLEX-tdTomato (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... P0-1 pups received the viral construct AAV9-hSyn-hChR2(H134R)-EYFP (200 µl at titer ≥ 1×10¹³ vg/mL, #26973-AAV9, Addgene, MA, USA) into the OB and the retrograde virus AAVrg-CamKIIα-mCherry (80 µl at titer ≥ 7×10¹² vg/mL ...
-
High-performance GPCR optogenetics based on molecular properties of animal opsins, MosOpn3 and LamPPbioRxiv - Biochemistry 2022Quote: ... The vector backbone containing SL1 and GFP was obtained by digestion of the plasmid [pEM1 = flp-21::LoxPStopLoxP::npr-1 SL2 GFP] (Addgene plasmid # 24033)65 with NotI and KpnI ...
-
bioRxiv - Developmental Biology 2021Quote: The pU6-chiRNA:sgRNA plasmid was obtained by incorporating the sgRNA sequence (obtained by annealing phos-gRNA-F and phos-gRNA-R, Supplementary Table 1) into pU6- BbsI-chiRNA (Addgene plasmid # 45946) (22 ...
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequences (sgRNA#1 TTGTTGCCCAGGGTTTAACA and sgRNA#2 CCCATCCCCGGCACCGGGTC) targeting the mouse Nlk locus were cloned into pSpCas9n(BB)-2A-Puro (Addgene #62987; PX462). Cells were transfected with gRNA and Cas9n-expressing plasmids using Lipofectamine 2000 and successfully transfected cells were selected with 3μg ml-1 puromycin for two days ...
-
bioRxiv - Neuroscience 2021Quote: ... the adeno-associated virus AAV2/1-Syn-FLEX-mRuby2-CSG-P2A-GCaMP6m-WPRE-SV40 (titer: 2.9 x 1013 GC per ml, Addgene accession no. 102816) in combination with AAV2/1.CamKII0.4.Cre.SV40 (titer ...
-
bioRxiv - Cell Biology 2022Quote: ... we first generated a doxycycline-inducible Cas9-expressing THP-1 cell line (iCas9-expressing cells) by transducing THP-1 cells with lentiviruses carrying the Lenti-iCas9-neo plasmid (a gift from Qin Yan; Addgene plasmid #85400). Multiple guide RNAs targeting a gene were cloned into the Lenti-multi-Guide plasmid (a gift from Qin Yan ...
-
bioRxiv - Cancer Biology 2022Quote: ... Plasmid pENTR223-1 GCN2 (NM_001013703) was purchased from Transomic Technologies and pLX303 was a gift from David Root (Addgene plasmid # 25897, RRID:Addgene_25897). GCN2 coding sequence was subcloned into the lentiviral vector pLVX-IRES-Hygromycin (Clontech ...
-
bioRxiv - Developmental Biology 2019Quote: A ROSA26 knock-in vector was constructed by insertion of CAG-Venus-IRES Pac gene expression cassette (Khoa et al., 2016) into the entry site of pROSA26-1 vector (kindly gifted from Philippe Soriano, Addgene plasmid # 21714) (Soriano ...
-
bioRxiv - Cell Biology 2020Quote: ... pENTR-backbone was created by treating pENTR-Luc (w158-1, a gift from Drs. Eric Campeau and Paul Kaufman; Addgene plasmid #17473) with NcoI and XbaI (New England Biolabs ...
-
bioRxiv - Genetics 2020Quote: ... BLRR was then transferred to pLenti CMV Puro DEST (w118-1)(33) (a kind gift from Eric Campeau & Paul Kaufman; Addgene plasmid #17452) from pENTR-BLRR using Gateway LR Clonase II Enzyme mix (111791020 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The HK2-targeting sequence 5’-CCGGCCAGAAGACATTAGAGCATCTCTCGAGAGATGCTCTAATGTCTTCTGGTTTTTT-3’ was cloned in the pLKO.1 hygro vector (a gift from Bob Weinberg; Addgene plasmid #24150). HK2 expression in Huh7-GCK+/HK2+ and Huh7-GCK+/HK2−Sh was analyzed on cell lysates by western blotting (Supplementary Fig ...
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293T cells were plated at 2.2 x 105 ml−1 and transfected the following day with shRNA-expressing plasmid (shSp7 or shLacZ plasmid) along with psPAX2 (Addgene, plasmid 12260) and pMD2.G (Addgene ...
-
bioRxiv - Neuroscience 2019Quote: ... eGFP expression was driven in DAT+ neurons by an AAV1:CAG:FLEX-eGFP vector (UPenn [Addgene], cat. no. AV-1-ALL854 [51502-AAV1]). For in-vivo fiber photometry of dopamine release (Fig ...
-
bioRxiv - Molecular Biology 2019Quote: ... ORF66 aa 1-200 was cloned into the NotI and XhoI sites of pcDNA4/TO-2xStrep (N-terminal tag) to generate pcDNA4/TO-2xStrep-ORF66 1-200 (Addgene plasmid #130954) and ORF66 aa 200-429 was cloned into the BamHI and XhoI sites of pcDNA4/TO-2xStrep (C-terminal tag ...
-
bioRxiv - Cell Biology 2021Quote: ... HEK293T cells were transiently transfected with 1 µg of a PCR cassette and 1 µg of pCAG- enAsCas12a(E174R/S542R/K548R)-NLS(nuc)-3xHA (gift from Keith Joung & Benjamin Kleinstiver, Addgene plasmid # 107941) using TransIT293 (Mirus ...
-
bioRxiv - Biochemistry 2021Quote: ... DNA encoding CGI-99 (Uniprot Q9Y224) was cloned into site 1 of the UC Berkeley MacroLab 5A vector (gift from Scott Gradia, Addgene plasmid #30121), while DNA sequence encoding FAM98B (Uniprot Q52LJ0 ...