Labshake search
Citations for Addgene :
1451 - 1500 of 1780 citations for 7 Chloro 3 nitro 3 4 dihydro 1H quinolin 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... 2 × 104 HEK293T target cells transfected with 500 ng of a human ACE2 expression plasmid (Addgene) were seeded in a white flat-bottom 96-well plate one day prior to the assays ...
-
bioRxiv - Biophysics 2023Quote: Dendra-2 EEA1 was generated by replacing TagRFP-T in RagRFP-T EEA1 (Addgene plasmid #42635) at cloning sites AgeI and XhoI ...
-
bioRxiv - Biochemistry 2023Quote: ... SARS-CoV-2 Mac1 without CFP-tag was cloned and expressed from pNH-TrxT (Addgene #173084).
-
bioRxiv - Genetics 2023Quote: ... All the plasmids developed in this work (Table 2) will be available from Addgene (Massachusetts, USA) once the manuscript is accepted for publication.
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 whole spike protein HexaPro was a gift from Jason McLellan (Addgene plasmid # 154754). SARS-CoV-2 HexaPro was expressed in Expi293F cells and purified with Ni-NTA resin followed by size exclusion as described previously [61] ...
-
bioRxiv - Cancer Biology 2023Quote: ... Vectors used included pGIPZ-GFP-Puro (see Supplementary Materials) and psPAX.2 and pMD2.G (Addgene). Cell transfections were done in Opti-MEM (Life Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... Oligonucleotides were annealed and cloned in BsmBI–digested lentiCRISPRv.2-puro plasmid (catalogue no. 52961; Addgene). Lentiviral particles for cloned lentiCRISPRv.2 were generated by transfecting human embryonic kidney (HEK ...
-
bioRxiv - Genetics 2023Quote: pHarvester was generated using pCFD5-gRNA#1&2 and pnos-Cas9-nos plasmids (Addgene no: 62208). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: Heterozygous ChAT-Cre mice were bilaterally injected with 1.0 µL of pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (diluted 1:2 in dPBS; Addgene: 100845-AAV5) in basal forebrain (AP ...
-
bioRxiv - Microbiology 2024Quote: Mammalian expression vectors used were pcDNA3.1-Ha-Dynamin 2.WT (gift of S. Schmid; Addgene 34684), pcDNA3.1-Ha-Dynamin 2.K44A (gift of S ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 µL of the adeno-associated viral vector rAAV9/1.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, #20298-AAV9) was dyed with 0.3 µL fast green (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2021Quote: For mammalian 2-hybrid assays 2.15 x 105 HEK293 or 4 x 105 A375 cells were transiently transfected with 1 µg firefly luciferase reporter plasmid (5xGAL4-TATA-luciferase, Addgene, 46756) (Sun et al ...
-
bioRxiv - Neuroscience 2022Quote: ... 90ul cells suspension containing 1M cells was mixed with 10 uL DNA mix: 4 ug pSpCas9(BB)-2A-Puro (PX459) plasmid (Addgene #48139), • 0.4 ug gRNA encoding plasmid (pKLV-U6gRNA(BbsI)-PGKzeo2ABFP ...
-
bioRxiv - Immunology 2019Quote: ... or VPR WT or a Q65R VPR mutant were produced through co-transfection of 293T cells with 4 plasmids coding for Gag/Pol (Addgene #12251), Rev (Addgene #12253) ...
-
bioRxiv - Molecular Biology 2021Quote: We performed a genome-wide CRISPR knock-out (KO) screen using the lentiviral Brie sgRNA library comprising 4 sgRNAs per protein-coding gene (Addgene #73632) (Doench et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... the fibroblasts were reprogrammed using the three plasmids (pCXLE-hOct3/4 [Addgene #27076], pCXLE-hSK [Addgene #27078], pCXLE-hUL [Addgene #27080]) with 10ug of each plasmid through the Amaxa Nucleofector (Lonza) ...
-
bioRxiv - Neuroscience 2020Quote: ... the fibroblasts were reprogrammed using the three plasmids (pCXLE-hOct3/4 [Addgene #27076], pCXLE-hSK [Addgene #27078], pCXLE-hUL [Addgene #27080]) with 10ug of each plasmid through the Amaxa Nucleofector (Lonza) ...
-
bioRxiv - Neuroscience 2021Quote: ... The patient-specific iPSCs were generated from LCLs by transfection with a combination of episomal plasmids (pCE-hOCT3/4, pCE-hSK, pCE-hUL, and pCE-mp53DD) (Addgene Inc.), as previously reported (Barrett et al ...
-
bioRxiv - Biophysics 2020Quote: ... A homozygous clone that passed all QC (U2OS HP1⍺ 4) was co-transfected with the transposon vector pEF1a-OsTIR-IRES-NEO-pA-T2BH (Addgene 127910) and SB100X in pCAG globin pA (Addgene 127909) ...
-
bioRxiv - Biochemistry 2022Quote: ... All plasmids generated by this study have been deposited to Addgene for distribution (See Supplemental Table 4 for Addgene accession numbers).
-
bioRxiv - Neuroscience 2021Quote: HEK293 cells were transfected with 500 ng of equimolar pooled SCN1A_h1b sgRNAs (Table 4) and 500 ng dCas9p300Core (Addgene, plasmid #61357) using Lipofectamine 3000 ...
-
bioRxiv - Microbiology 2019Quote: ... and at 28°C for 4 hours if using a temperature-sensitive plasmid (pIMAY, gift from Tim Foster, Addgene plasmid # 68939) (Lee et al. ...
-
bioRxiv - Immunology 2021Quote: ... Platinum-E cells were transfected at 70-80% confluency on 10 cm plates with 4 μg pCL-Eco(40) and 6 μg of either pMSCV-pBabeMCS-IRES-RFP (Addgene; 33337) or pMSCV-Myc-IRES-RFP (Addgene ...
-
bioRxiv - Developmental Biology 2022Quote: ... 35 μl of hot glycerol was cooled to 4°C then 35 μl of the primer mixture and 25 μl of Tn5 (Addgene #112112) was added and mixed and held at 1 hr at RT with gentle pipet mixing every 15 min ...
-
bioRxiv - Cell Biology 2022Quote: ... Retrovirus expressing NFAT1-GFP was constructed by inserting BglII/HpaI NFAT1-GFP fragment from HA-NFAT1(4-460)-GFP plasmid (Addgene #11107) into BglII/HpaI sites of pMSCV-Blasticidin plasmid (addgene #75085 ...
-
bioRxiv - Cancer Biology 2023Quote: ... they were transduced with lentivirus containing pLenti_CMV_GFP_Hygro [pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau & Paul Kaufman (Addgene viral prep #17446-LV)] at a multiplicity of infection of 10 for 48 hours before washing with PBS and replacing with fresh medium ...
-
bioRxiv - Cell Biology 2024Quote: ... The hDLXI56i enhancer was originally obtained from CN1851-rAAV-hI56i-minBglobin-iCre-4×2C-WPRE3-BGHpA (Graybuck et al., 2021) (Addgene #164450).
-
bioRxiv - Immunology 2021Quote: ... the human CRISPR 2-plasmid activation pooled library (SAM) was a gift from Feng Zhang (Addgene #1000000078) and used for CRISPR activation screening ...
-
bioRxiv - Synthetic Biology 2020Quote: ... targeting the LMNB1 gene (GGGGTCGCAGTCGCCATGGC) (2 ug) and an LMNB1-mEGFP containing repair vector (Addgene plasmid #87422) (3 μg ...
-
bioRxiv - Microbiology 2021Quote: ... The SARS-CoV-2 S-mEmerald construct was made by cloning the mEmerald sequence (Addgene, Plasmid #53976) to the C-terminal end of the SARS CoV-2 S-protein in the pCG expression vector ...
-
bioRxiv - Neuroscience 2020Quote: kn-p65AD was generated by co-injecting pBS-KS-attB2-SA(2)-T2A-p65AD-Hsp70 (Addgene #62915) and ΦC31 into the embryos of MI15480 (BL61064) ...
-
bioRxiv - Cancer Biology 2021Quote: Guide RNAs for TP53 and SETD2 were constructed and cloned into lenti CRISPR v-2 (Addgene, 52961) according to the original online protocol of the Zhang lab (http://www.genome-engineering.org/crispr/wp-content/uploads/2014/05/CRISPR-Reagent-Description-Rev20140509.pdf) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and 0.5 μg of SARS-CoV-2 Spike plasmid (a gift from Fang Li, Addgene plasmid #145032) using Lipofectamine 3000 transfection reagent (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... Retroviruses were generated by co-transfection of viral vectors (2 μg) with pCMV-VSVG (0.25 μg) (Addgene) into Phoenix-gp cells with 90% confluency in a 6-well plate ...
-
bioRxiv - Microbiology 2022Quote: ... and are also available on Addgene (pLVX-EF1alpha-SARS-CoV-2-nsp14-2xStrep-IRES-Puro, Addgene #141380). Nsp10-Flag plasmid was a gift from the Ott lab.
-
bioRxiv - Biophysics 2022Quote: ... These cells (1.5 × 106) were transfected with 2 μg of plasmid encoding eGFP-Cre recombinase (Addgene # 11923), a gift from Brian Sauer (Le et al. ...
-
bioRxiv - Immunology 2022Quote: ... the SARS-CoV-2 S HexaPro plasmid was a generous gift from Jason McLellan (Addgene plasmid # 154754) (19) ...
-
bioRxiv - Neuroscience 2020Quote: ... for imaging hippocampal pyramidal cells or pAAV-mDlx-GCaMP6f-Fishell-2 (a gift from Gordon Fishell, Addgene plasmid # 83899 ...
-
bioRxiv - Neuroscience 2021Quote: ... mice received 50 nL of helper AAV2/8 syn.dio.TVA.2A.GFP.2A.B19G (UNC vector core) followed 2 weeks later by 300nl of rabies SAD.B19.EnvA.ΔG.mCherry (SAD-B19 strain, Addgene Cat# 32636 prepared by the Salk institute vector core ...
-
bioRxiv - Neuroscience 2022Quote: ... and SNORD115 were designed using MIT’s CRISPR Design Tool (http://crispr.mit.edu; Supplemental Table 2) and cloned into pX459v2.0 (Addgene 62988) vector ...
-
bioRxiv - Cancer Biology 2020Quote: ... or with 2 μg/ml puromycin (Gibco) (pTK93_Lifeact-mCherry; a gift from Iain Cheeseman, Addgene plasmid #46357) for 3 days ...
-
bioRxiv - Immunology 2021Quote: Plasmid pCMV14-3X-Flag-SARS-CoV-2 S was a gift from Zhaohui Qian (Addgene plasmid # 145780)68 ...
-
bioRxiv - Microbiology 2022Quote: ... UL123 was also cloned into pLVX-EF1alpha-SARS-CoV-2-nsp1-2XStrep-IRES-Puro (Addgene plasmid #141367) in place of the SARS-CoV-2-nsp1-2XStrep cassette ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli codon optimized SARS-CoV-2 genes from plasmid vectors synthesized by GinkoBioworks and distributed by Addgene. Amplified genes were digested with NdeI and SacI ...
-
bioRxiv - Physiology 2022Quote: ... The pTwist-EF1a carrying the SARS-CoV-2 E protein with 2xSTREP tags were obtained from Addgene. pCMV-rpHluorin-N1 was a kind gift from Dr ...
-
bioRxiv - Microbiology 2023Quote: ... along with a luciferase gene with SARS-CoV-2 packaging sequence PS9 into 293T cells (Addgene 177942). Plasmids were gifts from Jennifer Doudna ...
-
bioRxiv - Cancer Biology 2023Quote: ... A CRISPR/dCas9 vector was constructed as follows: pX330A_dCas9-1×2 (Addgene, Watertown, MA; plasmid ID 63596) (20 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sequences (shPROX1-1: TGCTGTTGACAGTGAGCGCGAGGACCAAGATGTCATCTCATAGTGAAGCCACAGATGTATGAGATGAC ATCTTGGTCCTCATGCCTACTGCCTCGGA; shPROX1-2: TGCTGTTGACAGTGAGCGCCCCCGAGAAAGTTAC AGAGAATAGTGAAGCCACAGATGTATTCTCTGTAACTTTCTCGGGGATGCCTACTGCCTCGGA) were cloned into the LT3GEPIR backbone100 (Addgene; 111177) and used to generate lentiviral particles to transduce into organoids as described99 ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids encoding HCoV-229E and SARS-CoV-2 N proteins were obtained from Addgene (#151912 and #141391). C-terminally FLAG-tagged 229E N and SARS-CoV-2 N constructs were cloned into pcDNA3.1 using specific primer sequences (Supplementary Table S1).
-
bioRxiv - Immunology 2023Quote: ... the SARS-CoV-2 S 6P expression vector was a gift from Jason McLellan (Addgene plasmid #154754). The secreted protein was captured by Strep-Tactin affinity chromatography ...