Labshake search
Citations for Addgene :
1451 - 1500 of 1676 citations for 6 Methyl 4H pyrido3 2 b1 4oxazin 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... 200nl of adeno-associated virus 2 (AAV2) containing either control construct (pAAV-hSyn-EGFP; plasmid #50465; Addgene, Watertown, MA) or excitatory DREADD (pAAV-hSyn-hM3D(Gq)-mCherry ...
-
bioRxiv - Neuroscience 2019Quote: ... 5.2×1012 gc/ml) and AAV2/5-hSyn-DIO-hM3Dq-mCherry (7.8×1012 gc/ml) were produced from Addgene plasmids #44362 and #44361 at the facility of Nantes University (UMR 1089 ...
-
bioRxiv - Microbiology 2021Quote: ... The pcDNA-FLAG-V5-Nsp10/14/16 vectors were constructed from pDONR223 SARS-CoV-2 Nsp10 (Cat. # 141264, Addgene), Nsp14 (Cat ...
-
bioRxiv - Developmental Biology 2021Quote: ... Two guides were designed using the http://crispr.mit.edu tool (guide 1: CGGCTACTCCACTGTGGCGG; guide 2: CGCTTCTTGGGCCGGATGAG) and were cloned into the pX458 plasmid (Addgene, #48138) as previously described (55) ...
-
bioRxiv - Immunology 2021Quote: ... Virus was harvested from GP-2 cells transfected with SINV vectors and VSV-G (pMD2.G, Addgene plasmid #12259) and grown in DMEM supplemented with 30% FBS and 2mM glutamine ...
-
bioRxiv - Cancer Biology 2020Quote: shRNAs from the library (Supplemental Table 2) were annealed and cloned into a pLKO.1_neo plasmid (a gift from Sheila Stewart; Addgene plasmid # 13425 ...
-
bioRxiv - Neuroscience 2020Quote: ... mEos3.2-C1 was a gift from Michael Davidson & Tao Xu (Addgene plasmid # 54550; http://n2t.net/addgene:54550; RRID: Addgene_54550). Vcl-T-mEOS3.2-LifeAct was generated by sub-cloning a Vcl-T-T2A fragment in mEOS3.2-LifeAct clone.
-
bioRxiv - Molecular Biology 2022Quote: ... psPAX2 packaging vector (2 µg, a gift from Didier Trono; Addgene plasmid #12260; http://n2t.net/addgene:12260; RRID: Addgene_12260), and pMD2G envelope plasmid (4 µg ...
-
bioRxiv - Molecular Biology 2022Quote: A single guide RNA (sgRNA) (GCAGTGACTGTGTACGTGAG) that targets exon 2 of eIF2D was cloned into lentiCRISPR v2 plasmid (Addgene). HEK293 cells were plated into 6-well plates at 4 × 105 cells per well ...
-
bioRxiv - Neuroscience 2022Quote: ... excitatory Gq-coupled DREADDs (hSyn-hM3Dq-mCherry-AAV1/2 viral stocks, 4.0 × 1011 GC/mL titer, plasmid #50474 from Addgene), and control construct (hSyn-enhanced green fluorescent protein (EGFP)-AAV2 1:10 dilution of viral stocks ...
-
bioRxiv - Cell Biology 2022Quote: ... Tagging of the endogenous locus of SMC3 was done according to the CRISPaint protocol57 using 2.5 μg frame selector plasmid (pCAS9-mCherry-Frame+2; Addgene_6694157), 2.5 μg target selector plasmid (pCS446_pSPgSMC3 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral particles were produced in HEK293T cells using packaging and envelope constructs pCMVΔ8.2 and pMD.G-VSV-G (pCMVΔ8.2 and pMD.G-VSV-G were gifts from Bob Weinberg, Addgene plasmids #8454, #8455), and concentrated using fast-trap virus purification and concentration kit according to manufacturer′s instructions (Millipore) ...
-
bioRxiv - Neuroscience 2024Quote: ... into the DR and bilateral infusions of AAVretro-hSyn-DIO-EGFP (200 nL over 2 min; 1.3 x 1013 GC/mL, Addgene) into the BLA ...
-
bioRxiv - Immunology 2024Quote: ... the single guide RNA (sgRNA) sequences targeting exon 1 or 2 of murine IFNγR1 were cloned into the pX458 backbone (Addgene) containing Cas9 expression and GFP expression ...
-
bioRxiv - Cell Biology 2023Quote: ... We generated monoclonal U2OS cell lines expressing the following fluorescent plasmids: 1) ptfLC3B was a gift from Tamotsu Yoshimori (Addgene plasmid #21074; http://n2t.net/addgene:21074; RRID:Addgene_2107443; 2) pMXs-puro GFP-DFCP1 was a gift from Noboru Mizushima (Addgene plasmid #38269 ...
-
bioRxiv - Systems Biology 2022Quote: ... or 1-2 x 105 cells/mL for pCL040-based inducible protein expression vectors (to be deposited on Addgene) to account for differences in infection efficiency ...
-
bioRxiv - Immunology 2023Quote: The expression construct used to generate SARS-CoV-2 spike protein was a gift from Jason McLellan (Addgene #154754). Spike protein was prepared as previously described in20 ...
-
bioRxiv - Systems Biology 2023Quote: ... psPAX2 packaging vector (2 μg, a gift from Didier Trono (Addgene plasmid #12260; http://n2t.net/addgene:12260; RRID: Addgene_12260)) ...
-
bioRxiv - Molecular Biology 2023Quote: pDONR207 SARS-CoV-2 NSP1 was a gift from Fritz Roth (Addgene plasmid # 141255; http://n2t.net/addgene:141255; RRID: Addgene_141255). NSP1 coding sequence was cloned into the mammalian expression pCDNA5-FRT/TO-2xSTREP-3xHA vector ...
-
bioRxiv - Genomics 2022Quote: ... Each 15-cm2 plate was transfected with a total of 21 μg of plasmid DNA (1:2:1 ratio psPAX2-D64V:pLenti-STARR:pLAI-Env) [psPAX-D64V (Addgene #63586), and pLAI-HIV (Addgene #133996)] ...
-
bioRxiv - Neuroscience 2023Quote: ... and after 2 weeks of expression injected AAV8-EF1a-Con-Foff 2.0-GCamp6m-WPRE into PL (Addgene 137120-AAV8). For recordings from PL-VTA neurons ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 μl and 500 nl of AAV9-hSyn-GRAB-rDA1m (2 x 10^13 vg/ml; Addgene, 140556-AAV9) were injected into the dorsal striatum (AP 0.5 mm ...
-
bioRxiv - Cancer Biology 2023Quote: ... HEK 293T cells were transfected with either sulfatase 1 or sulfatase 2 expression plasmids or empty vector control derived from pcDNA3.1 (RRID: Addgene_79663) using Lipofectamine 3000 (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... were ordered from Sigma Aldrich as oligonucleotides (Table 2) and were cloned into pSpCas9(BB)-2A-GFP (PX458, a gift from Feng Zhang, Addgene plasmid #48138 ...
-
Structural and mechanistic insights into disease-associated endolysosomal exonucleases PLD3 and PLD4bioRxiv - Biochemistry 2023Quote: ... PLD3 KO cell line was generated from HEK293BlueTM hTLR9 by transfecting 2 μg hSpCas9-sgRNA expressing plasmid (Addgene #99154) cloned with gRNA sequence 5′-guccucauucuggcgguugu-3′ ...
-
bioRxiv - Neuroscience 2024Quote: Mice were injected with AAV1-mDlx-GCaMP6f-Fishell-2 (titer: 4.43E13; developed in the lab of Gordon Fishell; purchased from Addgene: plasmid #83899 ...
-
bioRxiv - Microbiology 2024Quote: All sgRNA oligonucleotides (Supplementary Table 2) were obtained from MilliporeSigma and cloned into the pLentiGuide-Puro plasmid (Addgene, #53963) as previously described 51,52 ...
-
bioRxiv - Genetics 2020Quote: ... The C-terminal portion of the hygromycin resistance gene and the unc-54 3’ UTR were then independently amplified from pCFJ1663 (Addgene #514840 from the lab of Erik Jorgensen) and inserted into the SbfI site of pMS4 to create the final landing pad plasmids (pMS70-75) ...
-
bioRxiv - Microbiology 2020Quote: ... and 3 µg of pCAGGS-S (SARS-CoV-2)(Catalog No. NR-52310: BEI Resources) or VSV-G (a gift from Tannishtha Reya (Addgene plasmid # 14888 ...
-
bioRxiv - Cell Biology 2020Quote: ... Nsp1-NT (1-127 aa) and Nsp1-CT (128-180 aa) were amplified from pDONR207 SARS-CoV-2 NSP1 (Addgene) by PCR and then cloned into pDB-His-MBP or BacMam pCMV-Dest plasmid ...
-
bioRxiv - Cell Biology 2020Quote: Two previously described sgRNAs specific to the Kap1 gene10 (Supplementary Table 2) were incorporated into plentiGuide-puro vector (Addgene #52963). For production of lentiviral particles ...
-
bioRxiv - Immunology 2021Quote: The SARS-CoV-2 pseudoviral particles expressing COVID-19 spike protein pGBW m4137384: S protein was purchased from Addgene (149543) and the virus particles were produced as describe previously (Hoffmann et al. ...
-
bioRxiv - Microbiology 2021Quote: ... pEZY-FLAG-Nsp14 vector was constructed from pDONR223 SARS-CoV-2 Nsp14 vector to the pEZY-FLAG (Cat # 18700, Addgene) destined vector ...
-
bioRxiv - Molecular Biology 2021Quote: ... and gGene-N2a and gGene-N2b for Nickase 2) cloned into tandem U6 cassettes in a version of pX330 plasmid (pX330-U6-Chimeric_BB-CBh-hSpCas9, Addgene #42230) mutated to express Cas9D10A-T2A-GFP (Nickase-1/2) ...
-
bioRxiv - Neuroscience 2022Quote: The pCMV-hEAAT2 plasmid encoding the human excitatory amino acid transporter type 2 (EAAT2) was a gift from Susan Amara (Addgene plasmid # 32814 ...
-
bioRxiv - Bioengineering 2022Quote: ... sgRNA cassette) were PCR-amplified and recloned into 2 lentiviral plasmids (pLKO.1 neo, Addgene #13425; pLJM-EGFP, Addgene #19319) and ...
-
bioRxiv - Biophysics 2022Quote: Live cell Mpro proteolytic cleavage activity assays were performed by co-transfecting HEK 293T cells with either the pmNG-Mpro-Nter-auto-NLuc or the pmNG-Mpro-Nter-auto-L-NLuc Mpro sensor plasmid constructs along with either pLVX-EF1alpha-SARS-CoV-2-nsp5-2xStrep-IRES-Puro (Mpro WT) (a gift from Nevan Krogan (Addgene plasmid # 141370 ...
-
bioRxiv - Cell Biology 2022Quote: ... Dynamin 2-mTFP1 (or dynamin 1-mTFP1) construct was created by replacing the EGFP tag of dynamin 2-EGFP (or dynamin 1-EGFP, Addgene) with mTFP1 (Addgene) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The expression vectors of the full-length SARS-CoV-2 spike and the human serine protease TMPRSS2 with a C-terminal C9-tag (TETSQVAPA) were acquired from AddGene (Summit Pharmaceutical International ...
-
bioRxiv - Synthetic Biology 2019Quote: We first obtained the yeast strain containing the reporter gene by integrating (lexA-box)x-PminCYC1-Citrine-TCYC1 plasmids (x = 4, 2 or 1) (Addgene plasmids #58434 ...
-
bioRxiv - Genetics 2020Quote: Prime Editor 2 (PE2) plasmid coding for the SpCas9 gene fused with the MLV reverse transcriptase was obtained from Addgene Inc ...
-
bioRxiv - Neuroscience 2020Quote: ... injections of rAAV2-retro-Cre (produced by Salk Vector Core or Vigene, 2×1012 to 1×1013 viral genomes/ml, produced with capsid from Addgene plasmid #81070 packaging pAAV-EF1a-Cre from Addgene plasmid #55636 ...
-
bioRxiv - Biochemistry 2021Quote: ... PINK1 and PARKIN (Supplemental Table 2) were designed using CRISPOR.org14 and inserted into LentiCRISPRv2 plasmid15,16 (a gift from Feng Zhang (Addgene plasmid # 52961), as done before7 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Expi293F cells were transfected with pcDNA3-SARS-CoV-2-S-RBD-sfGFP (a gift from Erik Procko, Addgene plasmid # 141184) using ExpiFectamine™ 293 Transfection Kit according to manufacturer’s directions (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: The human codon-optimized CAS9 with 2×35S CaMV promoter and Nos terminator was amplified from pAGM4723 plasmid (Addgene# 49772) using KpnI forward and PacI reverse primers (Supplemental Table 9) ...
-
bioRxiv - Microbiology 2021Quote: Individual sgRNAs (sgLRRC15 #1: GACATGCAGGCACTGCACTG; sgLRRC15 #2: AGTGTCAGCCCGGGACATGC; sgACE2: GTTACATATCTGTCCTCTCC) targeting the candidate genes were cloned into linearized pXPR_502 (Addgene, #96923) for CRISPR activation ...
-
bioRxiv - Biophysics 2022Quote: ... RRID:Addgene_141370)85or pLVX-EF1alpha-SARS-CoV-2-nsp5-C145A-2xStrep-IRES-Puro (C145A mutant Mpro) plasmid (a gift from Nevan Krogan (Addgene plasmid # 141371 ...
-
bioRxiv - Genetics 2022Quote: ... We have also generated targeting fragments to insert arrays into MosTI sites that use hygromycin and Pmlc-2::gfp but have not tested these fragments (although we deposited the reagents with Addgene). The protocols are identical except for using targeting fragments and sgRNAs that are specific to each insertion site (listed in Supplementary Table 1) ...
-
bioRxiv - Microbiology 2022Quote: Chemical-genetic screens were initiated by thawing 2 × 1ml aliquots (1.0 OD600 units/mL) of the Mtb CRISPRi library (RLC12; Addgene 163954) and inoculating each aliquot into 19ml 7H9 supplemented with kanamycin (10 μg/mL ...
-
bioRxiv - Cell Biology 2022Quote: ... talin 2 shRNA-stable cells were co-transfected with Tln1 siRNA and EGFP-talin 1 head (Addgene plasmid no. 32856) or EGFP-talin 1 L325R (the mutant version ...