Labshake search
Citations for Addgene :
1451 - 1500 of 2937 citations for 3 Methyl 1 6 naphthyridine 2 carboximidamide hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: Kinesin-1-GFP: Plasmid coding for kinesin-1-GFP was purchased from Addgene repository (#129761) ...
-
bioRxiv - Biophysics 2022Quote: ... Kinesin 1 1-401 (K401) was PCR amplified from pWC2 plasmid (Addgene # 15960). Ncd 236-701 was PCR amplified from a plasmid gifted by Andrea Serra-Marques.
-
bioRxiv - Cancer Biology 2024Quote: ... NKX2-1 and mouse Foxa2 CDS were amplified using NKX2-1 (Addgene, #119173) and mFoxa2 (Addgene ...
-
bioRxiv - Developmental Biology 2021Quote: ... using program A-30 with 1.6 µg each of GFP and tdTomato circularised targeting vectors and 5 µg single gRNA vector PX459 (5’-TATACCTAATCATTATGCCG-3’) (Addgene, 48139, a gift from Feng Zhang). Homology arms flanking the target site were amplified from genomic DNA and cloned into pBluescript II SK(+ ...
-
bioRxiv - Cell Biology 2022Quote: ... IFT121 and IFT139 in IMCD-3 cells were designed using Benchling software and cloned into the pX330 vector (gift from Feng Zhang; Addgene plasmid # 42230; (Cong et al., 2013)) ...
-
bioRxiv - Cell Biology 2023Quote: ... JR20s were used to express Cas9 and our previously verified sgRNA (5’-TCGACAGCCTTATGGCGGAC-3’) targeting mouse PFN120 from pLentiCRISPRv2 (Addgene #52961; a gift from Feng Zhang) via lentiviral transduction ...
-
bioRxiv - Cancer Biology 2023Quote: ... The alleles also contain mutations that confer resistance to CRISPR/Cas9 editing (without changing the amino acid sequence) with all the sgRNAs against LKB1 in the Toronto Knockout version 3 (TKOv3) CRISPR library (Addgene 125517, a gift from Jason Moffat). These alleles were then cloned into pBABE-GFP (Addgene 10668 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and guide RNAs were cloned into plasmid pCFD3-dU6:3 (for Dlp, Mad and Med) or pCFD4-U6:1_U6:3 (for Babo, Brk, Dad, Sax, Shn, Smad2 and Wit) (Addgene #49410 and #49411, (Port et al., 2014)) ...
-
bioRxiv - Genetics 2020Quote: A pair of TALENs targeting zebrafish tnfaip3 (A20) exon 2 were generated using “PLATINUM Gate TALEN Kit” (Addgene, #1000000043). 0.2 ng of mRNA encoding the TALEN pair was delivered into the cytoplasm of wild-type zebrafish embryos at the one-cell stage ...
-
bioRxiv - Molecular Biology 2020Quote: ... These parental BV2 or BV2-Cas9 cells were transduced for 2 d with pXPR_011 lentivirus expressing eGFP (Addgene; 59702) and an sgRNA targeting eGFP at a multiplicity of infection (MOI ...
-
bioRxiv - Neuroscience 2021Quote: ... Pups were injected bilaterally with 2 μl of AAV9-hsyn-ACh3.0 (1.8×10^13 gc/ml) and 2 μl of AAV9-hsyn-NES-jRCaMP1b (2.5×10^13 gc/ml, Addgene) per hemisphere ...
-
bioRxiv - Systems Biology 2021Quote: ... We generated two independent miR-290-295_KO mESC lines by transfecting WT E14 mESCs with pX458-sgRNA_miR290-295_3/2 for KO1 (Addgene #172711, #172710) and pX458-sgRNA_miR290-295_1/2 for KO2 (Addgene #172709 and #172710) ...
-
bioRxiv - Microbiology 2021Quote: ... pCDNA3.1-SARS2-Spike expressing full-lengh Spike (S) protein from SARS-CoV-2 (GenBank accession number QHD43416.1) was purchased from Addgene. Expression plasmid encoding S protein from SARS-CoV (GenBank accession number AAP13567.1 ...
-
bioRxiv - Cell Biology 2021Quote: ... Two closely spaced NHSL1 specific sgRNA (sgRNA1: caccgTCGACTCTCCTCGTCCAAGT; sgRNA2: caccgCTGTCCACTACACGGCACCA) were designed using http://crispr.mit.edu and cloned into pX330S-2 (Addgene 58778) and pX330A_D10A_x2 (Addgene 58772 ...
-
bioRxiv - Molecular Biology 2022Quote: The lentiviral vectors pLVX-EF1alpha-IRES-Puro-2xStreg-SARS-CoV-2 (Nsp6, Nsp8, M) (Addgene plasmids #141395, #141372, #141374) were transfected into the HEK293T cells with packaging plasmids ...
-
bioRxiv - Cancer Biology 2022Quote: ... SCD ORF was cloned in pLenti PGK Puro DEST 5W(w529-2) (gift from Eric Campeau & Paul Kaufman73; Addgene plasmid #19068 ...
-
bioRxiv - Neuroscience 2022Quote: ... 200nl of adeno-associated virus 2 (AAV2) containing either control construct (pAAV-hSyn-EGFP; plasmid #50465; Addgene, Watertown, MA) or excitatory DREADD (pAAV-hSyn-hM3D(Gq)-mCherry ...
-
bioRxiv - Microbiology 2021Quote: ... The pcDNA-FLAG-V5-Nsp10/14/16 vectors were constructed from pDONR223 SARS-CoV-2 Nsp10 (Cat. # 141264, Addgene), Nsp14 (Cat ...
-
bioRxiv - Immunology 2021Quote: ... Virus was harvested from GP-2 cells transfected with SINV vectors and VSV-G (pMD2.G, Addgene plasmid #12259) and grown in DMEM supplemented with 30% FBS and 2mM glutamine ...
-
bioRxiv - Cancer Biology 2020Quote: shRNAs from the library (Supplemental Table 2) were annealed and cloned into a pLKO.1_neo plasmid (a gift from Sheila Stewart; Addgene plasmid # 13425 ...
-
bioRxiv - Neuroscience 2020Quote: ... mEos3.2-C1 was a gift from Michael Davidson & Tao Xu (Addgene plasmid # 54550; http://n2t.net/addgene:54550; RRID: Addgene_54550). Vcl-T-mEOS3.2-LifeAct was generated by sub-cloning a Vcl-T-T2A fragment in mEOS3.2-LifeAct clone.
-
bioRxiv - Molecular Biology 2022Quote: ... psPAX2 packaging vector (2 µg, a gift from Didier Trono; Addgene plasmid #12260; http://n2t.net/addgene:12260; RRID: Addgene_12260), and pMD2G envelope plasmid (4 µg ...
-
bioRxiv - Molecular Biology 2022Quote: A single guide RNA (sgRNA) (GCAGTGACTGTGTACGTGAG) that targets exon 2 of eIF2D was cloned into lentiCRISPR v2 plasmid (Addgene). HEK293 cells were plated into 6-well plates at 4 × 105 cells per well ...
-
bioRxiv - Neuroscience 2022Quote: ... excitatory Gq-coupled DREADDs (hSyn-hM3Dq-mCherry-AAV1/2 viral stocks, 4.0 × 1011 GC/mL titer, plasmid #50474 from Addgene), and control construct (hSyn-enhanced green fluorescent protein (EGFP)-AAV2 1:10 dilution of viral stocks ...
-
bioRxiv - Cell Biology 2022Quote: ... Tagging of the endogenous locus of SMC3 was done according to the CRISPaint protocol57 using 2.5 μg frame selector plasmid (pCAS9-mCherry-Frame+2; Addgene_6694157), 2.5 μg target selector plasmid (pCS446_pSPgSMC3 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral particles were produced in HEK293T cells using packaging and envelope constructs pCMVΔ8.2 and pMD.G-VSV-G (pCMVΔ8.2 and pMD.G-VSV-G were gifts from Bob Weinberg, Addgene plasmids #8454, #8455), and concentrated using fast-trap virus purification and concentration kit according to manufacturer′s instructions (Millipore) ...
-
bioRxiv - Neuroscience 2024Quote: ... into the DR and bilateral infusions of AAVretro-hSyn-DIO-EGFP (200 nL over 2 min; 1.3 x 1013 GC/mL, Addgene) into the BLA ...
-
Structural and mechanistic insights into disease-associated endolysosomal exonucleases PLD3 and PLD4bioRxiv - Biochemistry 2023Quote: ... PLD3 KO cell line was generated from HEK293BlueTM hTLR9 by transfecting 2 μg hSpCas9-sgRNA expressing plasmid (Addgene #99154) cloned with gRNA sequence 5′-guccucauucuggcgguugu-3′ ...
-
bioRxiv - Immunology 2023Quote: The expression construct used to generate SARS-CoV-2 spike protein was a gift from Jason McLellan (Addgene #154754). Spike protein was prepared as previously described in20 ...
-
bioRxiv - Systems Biology 2023Quote: ... psPAX2 packaging vector (2 μg, a gift from Didier Trono (Addgene plasmid #12260; http://n2t.net/addgene:12260; RRID: Addgene_12260)) ...
-
bioRxiv - Molecular Biology 2023Quote: pDONR207 SARS-CoV-2 NSP1 was a gift from Fritz Roth (Addgene plasmid # 141255; http://n2t.net/addgene:141255; RRID: Addgene_141255). NSP1 coding sequence was cloned into the mammalian expression pCDNA5-FRT/TO-2xSTREP-3xHA vector ...
-
bioRxiv - Neuroscience 2023Quote: ... and after 2 weeks of expression injected AAV8-EF1a-Con-Foff 2.0-GCamp6m-WPRE into PL (Addgene 137120-AAV8). For recordings from PL-VTA neurons ...
-
bioRxiv - Cell Biology 2023Quote: ... were ordered from Sigma Aldrich as oligonucleotides (Table 2) and were cloned into pSpCas9(BB)-2A-GFP (PX458, a gift from Feng Zhang, Addgene plasmid #48138 ...
-
bioRxiv - Neuroscience 2024Quote: Mice were injected with AAV1-mDlx-GCaMP6f-Fishell-2 (titer: 4.43E13; developed in the lab of Gordon Fishell; purchased from Addgene: plasmid #83899 ...
-
bioRxiv - Microbiology 2024Quote: All sgRNA oligonucleotides (Supplementary Table 2) were obtained from MilliporeSigma and cloned into the pLentiGuide-Puro plasmid (Addgene, #53963) as previously described 51,52 ...
-
bioRxiv - Neuroscience 2024Quote: ... the mixture of AAV2-retro-EF1a-Cre (2 × 1013 gc/mL) and AAV5-CAG-fDIO-ArchT-GFP (plasmid: Addgene #124640 ...
-
Mu-opioid receptor activation potentiates excitatory transmission at the habenulo-peduncular synapsebioRxiv - Neuroscience 2024Quote: ... bilateral injections (150 nl/ hemisphere) of AAV5-EF1a-DIO-ChR2:mCherry (2-2.5 x 1013 gc/ml, Addgene 20297) were made into MHb ...
-
bioRxiv - Molecular Biology 2024Quote: ... a synthetic guide RNA (sgRNA) targeting RAD18 exon 2 (AGACAATAGATGATTTGCTG) was cloned hSpCas9(BB)-2A-GFP (PX458, Addgene 48138). Parental cell lines were transfected using electroporation (Neon Transfection System MPK5000 ...
-
bioRxiv - Microbiology 2022Quote: ... or pLKO.1-blast (pLKO.1-blast was a gift from Keith Mostov (Addgene plasmid #26655 ...
-
bioRxiv - Neuroscience 2021Quote: ... Constructs included: AAV2/1-hSynapsin-1-jGCaMP8 constructs (pGP-AAV-syn1-jGCaMP8f-WPRE, Addgene plasmid #162376 ...
-
bioRxiv - Neuroscience 2020Quote: ... or 1 μl of AAV5-hSyn-DIO-mCherry (1012 particles.ml−1, Addgene, #50459-AAV5). The virus was infused at a rate of 0.2 μL.min−1 using microinjection cannula (33-gauge ...
-
bioRxiv - Molecular Biology 2020Quote: ... were diluted (1:100) and cloned into pLKO.1 TRC-Cloning vector (Addgene # 10878) that had been digested with EcoRI and AgeI ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 μL of AAV9-hsyn-cre-2a-tdT (Addgene#107738, titer ∼1×10^13) was diluted with 3 μL of PBS and was injected into the subarachnoid space of one hemisphere at the level of somatosensory cortex in Mtor-floxed-5XFAD mice ...
-
bioRxiv - Developmental Biology 2023Quote: ... ZIF-1 and GFP-nanobody::ZIF-1 sequences were amplified from pOD2046 (Addgene #89367) (Wang et al ...
-
bioRxiv - Neuroscience 2024Quote: ... mixed at a 1:1 ratio with AAV8-Ef1a-Con/Fon-mCherry (Addgene #137132) or pAAV8-hsyn-DIO-mCherry (Addgene #50459 ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1:5 AAV1-Ef1a-fDIO-tdTomato (128434-AAV1, Addgene, 1×10¹³ vg/mL) was made into the craniotomy ...
-
bioRxiv - Molecular Biology 2020Quote: ... residues 1-271 (Addgene #138421), and residues 1-133 (Addgene #138422 ...
-
bioRxiv - Molecular Biology 2020Quote: ... PLKO.1 (Addgene, #10878 [34]), for expression of Cas12a gRNAs ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 µg psPAX2 (Addgene, 12260), 2 µg lentiviral plasmids and 10 µl dH2O was further added with 150 µl serum free DMEM and 9 µl X-tremeGENE HP DNA Transfection Reagent (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-1 (Addgene, #170447), MERS-CoV (Addgene ...