Labshake search
Citations for Addgene :
1451 - 1500 of 2427 citations for 2 Methyl 4 piperidin 1 ylsulfonyl phenylboronic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... AAV-PHP.S-tdTomato (Addgene, 59462- PHP.S, titer ≥ 1×10¹³ vg/mL) was utilized ...
-
bioRxiv - Cancer Biology 2024Quote: The shRNA sequences were inserted into the pLKO.TRC.1 plasmid (Addgene, Cat#10878 ...
-
bioRxiv - Molecular Biology 2024Quote: ... into a vector derived from the pLKO.1 vector (Addgene #10878) with pre-crRNAs under control of the hU6 promoter and BFP under control of the EF-1α promoter.
-
bioRxiv - Cell Biology 2024Quote: ... Oligonucleotides for shRNAs were cloned into pLKO.1 vector (Addgene, #21297). The day before transfection ...
-
bioRxiv - Immunology 2024Quote: E2F-1 wt-pGex2TK was a gift from William Kaelin (Addgene plasmid # 21668 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The target sequences were inserted into a pLKO.1 vector (Addgene). As a negative control an shRNA containing a scramble sequence (ACAAGATGAAGAGCACCA ...
-
bioRxiv - Cancer Biology 2024Quote: ... PGC-1α cDNA from pcDNA4 myc PGC-1 alpha (Addgene #10974) was cloned into the FUBW backbone driven by a ubiquitin promoter ...
-
bioRxiv - Cell Biology 2024Quote: ... The PCR product was further cloned into pGEX-4T-1 (Addgene) in-frame with the N-terminal GST-tagged fusion construct(21) ...
-
bioRxiv - Molecular Biology 2024Quote: ... R-5’ CAGACGCGTTTAGCCCTCCCACACATAACCAGA 3’ from pLKO.1-Blasticidin vector (Addgene #26655), and ligated after AgeI and MluI digestion and gel purification with the vector backbones ...
-
bioRxiv - Microbiology 2024Quote: HIV-1 GagPol was expressed by pCMV ΔR8.2 (Addgene plasmid #12263). The pCAGGS HIV-1JRFL gp160 expression plasmid was kindly provided by Dr ...
-
bioRxiv - Biophysics 2024Quote: ... the pLKO.1 puro (Addgene; 8453; a gift from Bob Weinberg) backbone was used ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2-retro-EF1a-Cre (Addgene #55636, 1 × 1013 genomic copies (gc)/mL ...
-
bioRxiv - Cancer Biology 2024Quote: The knockdowns were performed using lentiviral plasmid pLKO.1-TRC (Addgene_10878). The plasmid was digested with EcoRI (NEB ...
-
bioRxiv - Biochemistry 2024Quote: Pantothenate kinase 1 (Pank1) plasmids were acquired from Addgene (p. 32871) and expanded in lysogeny broth overnight to an optical density of 0.8 ...
-
bioRxiv - Cancer Biology 2024Quote: pLKO.1 vector was obtained from Addgene (Addgene, Cat No# 10878), deposited graciously by the David Root lab(Moffat et al ...
-
bioRxiv - Bioengineering 2024Quote: ... psPAX2 encoding HIV-1 gag and pol (12260 purchased from Addgene), and pHIV-eGFP encoding eGFP (21373 purchased from Addgene ...
-
bioRxiv - Biochemistry 2024Quote: ... or (1/8)NORAD-4xenv8- FL-3’antiPNA (Addgene plasmid #199209). For all experiments ...
-
bioRxiv - Cancer Biology 2024Quote: ... the following constructs were used: pLKO.1 (sh ctrl, Addgene, 8453), pLKO.1-TRCN0000147551 (shNFKBIZ ...
-
bioRxiv - Molecular Biology 2021Quote: ... The p-EGFP plasmid (#6077-1) was purchased from Addgene (Watertown, MA); the pEGFP-TSC2 plasmid was created as previously described in (52 ...
-
bioRxiv - Neuroscience 2022Quote: ... pAAV-mDlx-GFP-Fishell-1 (gift from Gordon Fishell; Addgene plasmid # 83900) was used to cut out Dlx enhancer and HBB promoter with MluI and EheI (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... MKL-1 Cas9 cell line was developed using pCWCas9 Blast (Addgene #83481) with Blasticidin (10ug/mL ...
-
bioRxiv - Cell Biology 2022Quote: ... HIV-1-GAG fused with EGFP was purchased from Addgene (plasmid 80605). Ezrin plasmid was a generous gift of Adam Kwiatkowski (University of Pittsburgh School of Medicine ...
-
bioRxiv - Cell Biology 2022Quote: ... and pLKO.6 sfCherry were generated from pLKO.1 puro plasmid (Addgene plasmid # 8453 ...
-
bioRxiv - Neuroscience 2020Quote: ... and pCS2-FLAG-UBQLN1 plasmid (p4458 FLAG-hPLIC-1; Addgene plasmid # 8663) were gifts from Peter Howley (42) ...
-
bioRxiv - Neuroscience 2021Quote: ... and pCS2-FLAG-UBQLN1 plasmid (p4458 FLAG-hPLIC-1; Addgene plasmid # 8663) were gifts from Dr ...
-
bioRxiv - Cancer Biology 2020Quote: ... human PML SUMO-1 mutant and GFP-BLM were purchased from Addgene (#62804 ...
-
bioRxiv - Biochemistry 2021Quote: ... TRCN0000047920) and cloned into the lentiviral pLKO.1 vector (Addgene, Watertown, MA) as previously described 56 ...
-
bioRxiv - Neuroscience 2020Quote: ... Sham animals included virgins injected with halorhodopsin (AAV1.CaMKIIa.eNpHR.EYFP; Addgene; N=1) that received no optical stimulation ...
-
bioRxiv - Cell Biology 2021Quote: ... pLVX-GFP-Centrin-1 was a gift from Manuel Thery (Addgene #73331).
-
bioRxiv - Cancer Biology 2020Quote: pLKO.1-shmSlug4 was a gift from Bob Weinberg (Addgene plasmid # 40648), pPGS-hSLUG.fl.flag was a gift from Eric Fearon (Addgene plasmid # 25696) ...
-
bioRxiv - Cell Biology 2021Quote: ... pAAV-mDlx-GFP-Fishell-1 was kindly provided by Gordon Fishell (Addgene plasmid #83900 ...
-
bioRxiv - Cell Biology 2021Quote: ... but with a pLKO.1-based vector (gift from Elaine Fuchs, Addgene plasmid # 25999 ...
-
Activation of the Integrated Stress Response overcomes multidrug resistance in FBXW7-deficient cellsbioRxiv - Cancer Biology 2022Quote: ... DLD-1 cells were infected with pCLX-CHOP-dGFP lentiviruses (Addgene, 71299), single cell isolated ...
-
bioRxiv - Microbiology 2022Quote: ... The amplified TaPHB-1 was cloned into pcDNA3-RFP plasmid (#13032, Addgene) using HindIII and NotI restriction sites ...
-
bioRxiv - Biophysics 2022Quote: ... The transfer vector consisted of a modified pLKO.1 neo plasmid (Addgene) with expression of the shRNA sequences under control of 3× copies of the lac operator and a copy of the mNeonGreen fluorescence protein ...
-
bioRxiv - Biophysics 2022Quote: ... pGEMHE:mTREK-1(K271Q) was a gift from Dan Minor (Addgene plasmid # 133270) (Lolicato et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... Nontargeting shRNA in pLKO.1 (shSCR) was used as a control (Addgene). For sgRNA experiments ...
-
bioRxiv - Biochemistry 2021Quote: The FLAG-HSF-1 plasmid was purchased from Addgene (ID 32537, RRID:Addgene_32537), which was originally established by Dr Stuart Calderwood (40) ...
-
Serotonin Modulates an Inhibitory Input to the Central Amygdala from the Ventral Periaqueductal GraybioRxiv - Neuroscience 2022Quote: ... NC) or AAV9-hSyn-EGFP (diluted 1:10 in sterile PBS, Addgene) was injected bilaterally into the CeA of C57Bl/6J mice ...
-
bioRxiv - Molecular Biology 2020Quote: ... pLKO.1-Puro was a gift from Bob Weinberg (Addgene plasmid # 8453) (35) ...
-
bioRxiv - Pathology 2020Quote: ... the pLKO.1-puro empty vector was purchased from Addgene (Watertown, MA). A scrambled shRNA control and shRNAs specific for the mouse EZH1 and EZH2 genes were designed by RNAi Central (http://cancan.cshl.edu/RNAi_central/step2.cgi) ...
-
bioRxiv - Cell Biology 2020Quote: ... or GFP-K17ΔNLS cDNA (pEGFP-C3 vector backbone; Addgene REF# 6082-1) were transfected into cells using FuGENE HD Transfection Reagent (Promega REF# E2311 ...
-
bioRxiv - Neuroscience 2020Quote: ... or AAV9.hSyn Pr.DIO.hM4Di-mCherry (≥ 1×1013 vg/mL, Addgene # 44362-AAV9). For controls ...
-
bioRxiv - Cancer Biology 2020Quote: ... to 2μg pLKO.1 shRNA plasmid: 1500ng psPAX2 packaging plasmid (Addgene #12260): 500ng pMD2.G envelope plasmid (Addgene #12259 ...
-
bioRxiv - Microbiology 2020Quote: ... pcDNA3 HA eIF4GI (1–1599) was a gift from Nahum Sonenberg (Addgene plasmid #45640 ...
-
bioRxiv - Genomics 2021Quote: ... The Dlx promoter sequence was from pAAV-mDlx-GFP-Fishell-1 (Addgene plasmid #83900 ...
-
bioRxiv - Cell Biology 2021Quote: ... and a pLKO.1 backbone digested with AgeI/EcoRI (Addgene, cat# 26655), respectively ...
-
bioRxiv - Cell Biology 2020Quote: ... pLVX-IRES-Puro and pLKO.1-Puro plasmids were purchased from Addgene. Lentiviral vector pLKO.1-Puro was used to clone small hairpin RNAs (shRNAs) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and pLenti-CMV/TO-SV40 small + Large T (w612-1) (#22298, Addgene), respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV5-EF1a-fDIO-mCherry (1 × 1013 vg/ml, 100nl unilateral, #121675, Addgene), AAVrg-EF1a-DIO-FLPo-WPRE-hGHpA (titer 1.6 × 1013 vg/ml ...