Labshake search
Citations for Addgene :
101 - 150 of 689 citations for Recombinant Mouse TNFRSF4 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: The mouse Trim41 cDNA (ENSMUST00000047145) tagged with PA and 1D4 was inserted under the control of the mouse Clgn promoter (Addgene #173686) (Ikawa et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... two independent sgRNA against mouse Chk2 (GTATACATAGAGGATCACAG and GCTGGAGACAGTGTCTACCC) or mouse Trp53 (56) were cloned into pKLV-U6gRNA(BbsI)-PGKpuro2ABFP (Addgene, 50946). Lentiviral packaging plasmids (1µg pCMV-Rev ...
-
bioRxiv - Molecular Biology 2023Quote: Polymerase chain reaction (PCR) was used to isolate mouse AMPKγ1 cDNA from a mouse AMPKγ1-HA vector (#40605, Addgene, Watertown, MA, USA). Mouse AMPKγ1 cDNA was then cloned into the 3xFLAG-CMV10 vector (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... and NLS-stdMCP-stdHalo fusion proteins (Addgene plasmid #104999) (Voigt et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... and SAD-B19 helper proteins (N, 52.11 mg, Addgene 59924 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and NLS-stdMCP-stdHalo fusion protein (Addgene plasmid: 104999) (Voigt et al. ...
-
bioRxiv - Biophysics 2021Quote: ... The tandem PCP (tdPCP) protein was derived from Addgene plasmid #40650 ...
-
bioRxiv - Bioengineering 2020Quote: ... pMD2.G containing VSV-G envelop protein (Addgene, #12259) and pCMVΔR8.2 (Addgene ...
-
bioRxiv - Microbiology 2022Quote: ... individual proteins were cloned into vector 2-BT (Addgene #29666 ...
-
bioRxiv - Physiology 2022Quote: ... or tdTomato-EB3 fusion protein (Addgene, EB3-tdTomato, #50708) was performed as 5 repeated measurements × 5 cells × 3 independent experiments ...
-
bioRxiv - Bioengineering 2024Quote: ... transduced to express green fluorescent protein (GFP, Addgene: 72263) were cultured in DMEM supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2024Quote: The plasmid encoding the pABE8e-protein (Addgene plasmid #161788) was used to construct the plasmid encoding the His8-SsCBE2-C2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and mCherry-Snx9 (#27678) (all mouse) were from Addgene.
-
bioRxiv - Neuroscience 2020Quote: ... Postsynaptic mouse neuroligin-1 was PCR amplified from Addgene #15260 ...
-
bioRxiv - Genetics 2024Quote: Mouse CRISPR Brie lentiviral pooled library (Addgene Plasmid # 170511) consisting of 79,637 gRNAs was co-transfected with packaging plasmids (psPAX2 and pMD2.G ...
-
bioRxiv - Biophysics 2023Quote: ... mouse Opa1 sequence was cloned into pR26-CMVconst (Addgene plasmid #127373 ...
-
bioRxiv - Immunology 2020Quote: Plasmids containing fluorescent protein coding sequences mCerulean3-N1 (Addgene # 54730), mAzurite-N1 (Addgene # 54617) ...
-
bioRxiv - Biochemistry 2021Quote: ... Nsp12 protein was expressed from pFastBac vector 438C (Addgene #154759) in Hi5 insect cells ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 2 μg of pMD2.G coat protein vector (Addgene plasmid #12259 ...
-
bioRxiv - Systems Biology 2022Quote: ... Proteins were co-expressed with BirA (PET21a-BirA, Addgene #20857) in E ...
-
bioRxiv - Synthetic Biology 2020Quote: Expression vector encoding humanized pCas9_GFP protein was obtained from Addgene.org (Plasmid #44719) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Expression vectors encoding Anti-CRISPR proteins were obtained from Addgene: AcrIIA2 (pJH373 plasmid ...
-
bioRxiv - Synthetic Biology 2021Quote: ... a green florescence protein (GFP) derived from pJL1 (Addgene #69496), and a C-terminal twin-strep-tag (66) ...
-
bioRxiv - Biochemistry 2021Quote: ... or N-terminal His6 plus green fluorescent protein (GFP; RRID:Addgene_29716). Note that in the plasmid names for this clone the numbering of Syx residues was based on the Syx isoform from NCBI Reference Sequence NP_001036128.1 ...
-
bioRxiv - Genetics 2020Quote: ... and a blue fluorescent protein (BFP) expression cassette (Addgene #36086). The 1kb upstream and 1kb downstream arms were amplified from purified mouse genome from AB2.2 ES cells (ATCC #SCRC-1023 ...
-
bioRxiv - Genomics 2021Quote: ... Protein A (pA) was amplified from pK19pA-MN (ASP4062, Addgene plasmid #86973 ...
-
bioRxiv - Microbiology 2022Quote: ... we also expressed WT and D614 S-protein-FLAG (Addgene plasmids 156420 and 156421 ...
-
bioRxiv - Cell Biology 2024Quote: ... tropicalis proteins were cloned into the pHAT2 vector (Addgene #112583) using NEBuilder HiFi DNA Assembly Master Mix (NEB #E2621) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and p73C proteins were subcloned into pET15-b (Addgene, #24866), pET28-a ...
-
ER mediates spatial regulation of lysosome-endosome interactions via motion switch at junction sitesbioRxiv - Cell Biology 2023Quote: Plasmids encoding fluorescent fusion protein were either purchased from Addgene or constructed in house using ligation (NEB Cat# M2200S ...
-
bioRxiv - Cell Biology 2023Quote: ... a monomeric red fluorescent protein (RFP)-FKBP12 (Addgene, Plasmid #67514) (71 ...
-
bioRxiv - Cell Biology 2023Quote: ... and enhanced green fluorescent protein (eGFP) (Addgene, Boston, MA, USA). Cells were nucleofected using the Amaxa 4D-Nucleofector (Lonza ...
-
bioRxiv - Genetics 2024Quote: ... Self-purified Protein AG-MNase (pDNA was from Addgene; 123461) was used ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse Lhx2 cDNA was amplified from TetO-FUW-Lhx2 (Addgene #61537 ...
-
bioRxiv - Cell Biology 2022Quote: Mouse Drp1 was PCR amplified from pcDNA3.1 mDrp1 (Addgene #34706) and cloned into pLenti BlastR using InFusion cloning ...
-
bioRxiv - Molecular Biology 2020Quote: Mouse GFP-PGC-1α full length (FL) plasmid (Addgene, #4) was used as template for PCR amplification of a delta C-terminal domain (ΔCTD ...
-
bioRxiv - Cell Biology 2021Quote: The pcDNA 3.1 (-) mouse C/EBPδ expression vector (AddGene, #12559) and annealed oligonucleotides (Supplementary Table S4 ...
-
bioRxiv - Molecular Biology 2024Quote: Mouse Two Plasmid Activity-Optimized CRISPR Knockout Library (Addgene#1000000096) was amplified in E coli ...
-
bioRxiv - Cancer Biology 2024Quote: The mouse GeCKO v2 library was obtained from Addgene (#1000000052). LentiCRISPRv2 is a one-vector plasmid system for the mouse GeCKO (Genome-scale CRISPR Knockout ...
-
bioRxiv - Biophysics 2023Quote: ... Mouse TRPM5 in pcDNA3.1 was purchased from Addgene (plasmid #85189), human TRPM5 in pcDNA3.1+ (Accession No ...
-
bioRxiv - Molecular Biology 2023Quote: ... untagged mouse cDNA into a pBig1a vector70 (Addgene, Plasmid #80611). These untagged RING1B and BMI1 constructs were used for all experiments presented in this manuscript with the exception for the data presented in Figure 6C ...
-
bioRxiv - Molecular Biology 2021Quote: SARS-CoV-2 viral proteins were amplified via PCR from Addgene constructs with a 1x (GGGS ...
-
bioRxiv - Cell Biology 2019Quote: ... Plasmids for nanobody fusion protein expression are deposited with Addgene (Addgene: #109417 ...
-
bioRxiv - Genetics 2020Quote: ... R47H TREM2 or GFP proteins (Addgene; pCW57-GFP-2A-MCS, #71783). After 2-weeks of puromycin selection ...
-
bioRxiv - Cell Biology 2021Quote: Protein expression vector pET28a-mCherry-CNA35 was obtained from Addgene (#61607). Transformed E.coli (BL21 ...
-
bioRxiv - Bioengineering 2022Quote: ... a stimulatory G-protein coupled receptor (custom made Chemogenetics AAV: Addgene). Clozapine-N-oxide (CNO ...
-
bioRxiv - Neuroscience 2021Quote: ... The fusion protein was cloned into pAAV-CAG-GFP (Addgene #37825) by substituting the GFP with H2B- mGreenLantern using restriction enzymes BamHI and XhoI ...
-
bioRxiv - Bioengineering 2020Quote: Yellow fluorescence protein (pLEX_970_puro_DEST_YFP gifted by William Hahn (Addgene plasmid # 45295)) and mCherry (plv_mCherry gifted by Pantelis Tsoulfas ...
-
bioRxiv - Neuroscience 2022Quote: ... and a PCR amplicon containing the CRISPRoff-v2.1 protein from Addgene plasmid 167981 (gifted from Luke Gilbert [45] ...
-
bioRxiv - Cancer Biology 2019Quote: ... Bcl-2 proteins and their mutants (pMIG-Bcl-xL from Addgene, pMIG-BCL2 [6] ...