Labshake search
Citations for Addgene :
101 - 150 of 10000+ citations for Rat ERICH6 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... talin 2 shRNA-stable cells were co-transfected with Tln1 siRNA and EGFP-talin 1 head (Addgene plasmid no. 32856) or EGFP-talin 1 L325R (the mutant version ...
-
bioRxiv - Immunology 2020Quote: ... Generation of shRNA IFIT1 cells: 293T cells were co-transfected with psPax2 and pMD2.G (Addgene plasmids #12260 and #12259), as well as pLKO.1 (50 ...
-
bioRxiv - Immunology 2020Quote: ... UK) packaging construct in combination with pSuper.mBeta826 (DNA Polβ shRNA, a kind gift from Dr. Robert Sobol, [Addgene, Plasmid #12549]) (Trivedi et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... The shRNA constructs to knockdown human DNMT3A1/3A2 and scrambled controls were hDNMT3A shRNA pSMP-DNMT3A1 and pSMP-Luc (a gift from George Daley, Addgene plasmid #36380, Addgene plasmid #36394 ...
-
bioRxiv - Genomics 2021Quote: ... a gift from Bob Weinberg. The cloning of the shRNAs in the pLKO.1 plasmid was performed as per the Addgene’s pLKO.1 cloning protocol ...
-
bioRxiv - Immunology 2022Quote: ... or the scrambled shRNA sequence: CCGGCA-ACAAGATGAAGAGCACCAATTTTT were transfected overnight into 293 LentiX packaging cells (Takoro) along with VSV-G plasmid envelope (Addgene), aiming to generate shLRBA and shControl encoding lentiviruses ...
-
bioRxiv - Genetics 2023Quote: ... ngRNA and shRNA plasmids were generated by ligating annealed and phosphorylated oligos into a BsmBI-digested lentiGuide-Puro (Addgene #52963) or an EcoRI-digested pLKO.1 backbone using T4 DNA ligase (Addgene #8453) ...
-
bioRxiv - Cell Biology 2023Quote: ... with the shRNA vector and Virapower packaging plasmids (pMDLg/pRRE, Addgene #12251; pRSV-Rev, Addgene #12253; pMD2.G, Addgene #12259) according to manufacturer instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... with the shRNA vector and Virapower packaging plasmids (pMDLg/pRRE, Addgene #12251; pRSV-Rev, Addgene #12253; pMD2.G, Addgene #12259) according to manufacturer instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLKO.1 Scrambled shRNA (#1864, Addgene), pLKO.1 HIF2α shRNA (#TRCN0000082307 ...
-
bioRxiv - Developmental Biology 2022Quote: ... A scramble shRNA (Addgene-1864, CCTAAGGTTAAGTCGCCCTCGC) was used as control ...
-
bioRxiv - Bioengineering 2021Quote: ... shRNA knockdown of p53 (#27077; Addgene); Sox2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... shRNA sequences targeting NFS1 (Addgene, 102963), ISCU (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: shRNA vectors were created by annealing shRNA overlapping oligonucleotides and then cloned into pLKO.1 (Addgene, 10878). shRNA oligonucleotides sequences are detailed in Supplementary Table 1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The sequences of the control and ZEB1 shRNA were as follows: shRNA control (shCT) (Addgene sequence #1864):
-
bioRxiv - Cell Biology 2022Quote: All shRNA were generated by ligation of oligos into AgeI and EcoRI of pLKO.1 (Addgene plasmid #8453; Addgene, Teddington, UK). Lower case sequences represent the targeted sequences.
-
bioRxiv - Cell Biology 2022Quote: All shRNA were generated by ligation of oligos into AgeI and EcoRI of pLKO.1 (Addgene plasmid #8453; Addgene, Teddington, UK). Lower case sequences represent the targeted sequences.
-
bioRxiv - Cell Biology 2023Quote: ... NT#3-TTGGATGGGAAGTTCACCCCG) or IP3R1-targeting shRNA (ULTRA3316782- TTTCTTGATCACTTCCACCAG) were packaged as lentiviral particles using packaging (pCMV- dR8.2 dpvr, Addgene, plasmid #8455) and envelope vectors (pCMV-VSV-G ...
-
bioRxiv - Cancer Biology 2024Quote: ... ALKBH5 shRNA was generated by ligation of oligonucleotides into the AgeI and EcoRI restriction sites of pLKO.1 (Addgene plasmid #8453). Lentiviral-shRNA particles were generated by transfecting HEK 293T cells with 12 μg of pLJM1 vector containing the shRNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... Scramble shRNA pLKO.1 vector (Addgene, 1864) was used as a control.
-
bioRxiv - Molecular Biology 2022Quote: ... Nontargeting shRNA control was purchased from Addgene. Single siRNA duplex sequences targeting C1orf112 ...
-
bioRxiv - Physiology 2019Quote: ... Vectors were sourced from OriGene (Rockville, MD) for PISD-expressing plasmid (MR206380), Sigma (St. Louis, MO) for shRNA for mouse PISD (shPSD: TRCN0000115415, and Addgene (Cambridge, MA) for psPAX2 (ID #12260) ...
-
bioRxiv - Cancer Biology 2021Quote: ... KRT14 mouse and Human ShRNA sequence were cloned in the 3rd generation transfer plasmid pLKO.1 TRC cloning vector (Addgene cat # 10878) between unique AgeI and EcoRI restriction sites downstream of the U6 promoter ...
-
bioRxiv - Bioengineering 2021Quote: RNA Mango control and EXO-Probe gene fragments were synthesized (IDT) and cloned into the shRNA-expressing plasmid vector pSLQ1615 (Addgene, Watertown, MA). Plasmids were transformed into E ...
-
bioRxiv - Cancer Biology 2023Quote: ... and SNAI1 knockdown cells were generated by cloning respective shRNA sequences into the 3rd generation lentiviral plasmid pLKO.1 TRC cloning vector (Addgene, cat# 10878) between unique AgeI and EcoRI sites downstream of the U6 promoter ...
-
bioRxiv - Cell Biology 2023Quote: ... and the DAG maker C1δ-GFP amplified from rat PKCδ C1-containing plasmid (Addgene #21216) 61 was expressed from ura4 locus under scs2 promoter ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA 2 (shYAP1 #2) or scramble shRNA (shNC) were inserted into pLKO.1-TRC Cloning Vector (Addgene, 10878, RRID: Addgene_10878) following the manufacturer’s protocol and sequenced ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA 2 (shYAP1 #2) or scramble shRNA (shNC) were inserted into pLKO.1-TRC Cloning Vector (Addgene, 10878, RRID: Addgene_10878) following the manufacturer’s protocol and sequenced ...
-
bioRxiv - Cancer Biology 2019Quote: CXCR4 shRNA Sequence: 5’CCGGTCCTGTCCTGCTATTGCATTACTCGAGTAATGCAATAGCAGGACAGGATTTTTG 3’ was cloned into the 3rd generation transfer plasmid pLKO.1 TRC cloning vector (Addgene cat no. 10878) between unique AgeI and EcoRI sites downstream of the U6 promoter ...
-
bioRxiv - Cancer Biology 2024Quote: ... The construction of the two shRNA lentivirus vectors targeting the human β-catenin was performed following the Tet-pLKO Manual given by Addgene (plasmid#21915). The shRNA sequences used were the same as previously described (16) ...
-
bioRxiv - Cancer Biology 2021Quote: shRNA against β-catenin was purchased from Addgene (pLKO.1 puro shβ-catenin ...
-
bioRxiv - Cancer Biology 2022Quote: ... EVI1 shRNAs were cloned into pLKO2Tetpuro (Addgene #21915) sh1 (TGCAGGGTCACTCATCTAAAG) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pSUPER-retro-puro-GFP shRNA (Addgene #30519).
-
bioRxiv - Molecular Biology 2022Quote: ... we inserted shRNA sequences into pLKO.1 (Addgene) or shmirRNA (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: shRNA against β-catenin was purchased from Addgene (pLKO.1 puro shβ-catenin ...
-
bioRxiv - Biochemistry 2021Quote: ... shRNA targeting mSARM1 (5’-CCGGCTGGTTTCTTACTCTACGAATCTCGAGATTCGTAGAGTAAGAAACCAGTTTTTG-3’) or the scrambled shRNA (5’-CCGGCCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGGTTTTTG-3’) were inserted to pLKO.1-puro (Addgene, #8453) with EcoRI and AgeI ...
-
bioRxiv - Molecular Biology 2021Quote: ... and YTHDC1 were generated by cloning the shRNA (RNAi Consortium shRNA Library) from pLKO.1-puro into the pLKO.1-blast backbone (Addgene #26655).
-
bioRxiv - Cell Biology 2023Quote: Lentiviruses were generated in HEK293T cells by transient expression of the indicated shRNA vectors below with psPAX2 and pMD2.G packaging vectors (Addgene plasmids 11260 and 12259). For lentiviral production in 96 well plates ...
-
bioRxiv - Neuroscience 2020Quote: ... Raptor_1 shRNA was a gift from David Sabatini (Addgene plasmid # 1857 ...
-
bioRxiv - Microbiology 2024Quote: ... scramble shRNA was a gift from David Sabatini (Addgene plasmid # 1864 ...
-
bioRxiv - Neuroscience 2024Quote: ... and a bilateral infusion of either AAV2.CMV::nNOS-shRNA-EGFP or AAV2.CMV::luciferase-shRNA-EGFP combined with an AAV2.hsyn::DIO-mCherry (Addgene, titer: ∼7×1012) into the NAcore ...
-
bioRxiv - Neuroscience 2020Quote: ... or 20 μg pSuper-cofilin1-shRNA + 20 μg pSuper-ADF-shRNA (Bosch et al., 2014) + 8 μg pCAG-CyRFP1 (Addgene; (Laviv et al., 2016)) + 4 μg EGFP-N1 or 20 μg pSuper-cofilin1-shRNA + 20 μg pSuper-ADF-shRNA + 8 μg pCAG-CyRFP1 + 4 μg shRNA insensitive cofilin1-EGFP (Bosch et al. ...
-
bioRxiv - Cancer Biology 2019Quote: ... shRNAs were cloned into the retroviral expression vector LEPG (Addgene_111160) according to the procedure described previously31 ...
-
bioRxiv - Cancer Biology 2020Quote: ... shRNA sequences were constructed into pLKO-TET-ON (Addgene # 21915). Sequences of sgRNA and shRNA are provided in Supplementary Table 4 ...
-
bioRxiv - Immunology 2019Quote: ... and the two Rictor shRNA vectors were purchased from Addgene. The pEnter/D-TOPO entry vector was purchased from Thermo Fischer ...
-
bioRxiv - Cancer Biology 2021Quote: ... pMKO shRNA Bim was a gift from Joan Brugge (Addgene plasmid # 17235 ...
-
bioRxiv - Molecular Biology 2022Quote: ... or a control shRNA (a gift from David Sabatini; Addgene plasmid #1864 ...
-
bioRxiv - Cancer Biology 2023Quote: ... SERPINB3 knockdown cells were transduced with scramble shRNA (Addgene #1684) or SERPINB3 shRNA (Sigma Mission shRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... except for the scramble shRNA which was obtained from Addgene (a gift from David Sabatini ...
-
bioRxiv - Cancer Biology 2024Quote: shRNAs and were cloned into pLko.1-puro (Addgene #8453) linearized with AgeI and EcoRI ...