Labshake search
Citations for Addgene :
101 - 132 of 132 citations for Polyoxymethylene Homopolymer 20% PTFE Fiber Filled Granule since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: Pairs of gRNA plasmids were constructed by inserting a 20 bp target sequence (Supplementary Table S25) into an empty gRNA cloning vector (a gift from George Church; Addgene plasmid # 41824 ...
-
bioRxiv - Neuroscience 2024Quote: ... the DNA mixture consisted in 20 μg of specific DNA and 10 μg each of psPax2 and pMD2.G plasmids (from Dr. Didier Trono, Addgene) and 250 mM CaCl2 (in a final volume of 500 ul ...
-
bioRxiv - Neuroscience 2024Quote: ... A pulled glass pipette tip of 20–30 μm containing CTB647 (ThermoFischer Scientific, C34778) or retrograde AAV (Addgene, AAV-PHP.eB) and FG was lowered into the brain ...
-
bioRxiv - Neuroscience 2023Quote: ... we inserted a barcode sequence consisting of 20 random nucleotides in the 3’ untranslated region of the nucleoprotein gene in pRVΔG-4mCherry (Addgene #52488) (SAD B19 strain ...
-
bioRxiv - Cell Biology 2023Quote: ... A pair of 20-mer oligonucleotides targeting the 5’ end of the dtat coding sequence was ligated into pAc-sgRNA-Cas9 (Addgene) and validated by sequencing ...
-
bioRxiv - Neuroscience 2024Quote: ... and four small injections of a mixture of 1:20 AAV-hSyn-GCamP7f (104488-AAV9, Addgene, 1×10¹³ vg/mL) and 1:5 AAV1-Ef1a-fDIO-tdTomato (128434-AAV1 ...
-
bioRxiv - Cell Biology 2024Quote: Viral supernatants were produced by co-transfecting HEK293T cells at 70-80% confluency in a T175 flask with 20 μg pHIV-Luc-ZsGreen (gift from Bryan Welm (Addgene plasmid #39196 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 40 million cells per replicate were activated and 12-20 h later electroporated with the pSpCas9(BB)-2A-GFP plasmid (pX458; Addgene 48138) expressing the Myc sgRNA using the MaxCyte STx transfection system (MaxCyte) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Casper strains were available and 20 ng/μL DNA plasmids encoding mNG-GECO1 under the control of nuclear-localized elavl3/HuC promoter (Addgene: 59530) were injected into two-cell stage embryos of Casper mutant zebrafish33 with 40 ng/μl Tol2 transposase mRNA (26 ...
-
bioRxiv - Bioengineering 2020Quote: ... vectors were generated similarly to part vectors in 10 μL reactions with 20 fmol MTK landing pad entry backbone (Addgene #123932), 40 fmol of each expression vector plasmids ...
-
bioRxiv - Bioengineering 2020Quote: ... 1 pmol of the oligo mix was added to a 20 μl Golden Gate reaction containing 100 ng destination plasmid (pATT-DEST, Addgene #79770), 10 units BsaI (NEB #R3733) ...
-
bioRxiv - Cell Biology 2021Quote: ... The sgRNA (100 ng/μl) and SEC repair template (20 ng/μl) plasmids combined with Peft-3::Cas9 (60 ng/μl; Addgene #46168) and Pmyo-2::mCherry co-injection marker (2.5 ng/μl ...
-
bioRxiv - Immunology 2020Quote: ... antisense: aaacCAGTGATGTCACCCGTGTGC) were hybridised and ligated into the Bsm BI site of pLentiGuide-Puro (gift from Feng Zhang, Addgene # 52963 (20)) ...
-
bioRxiv - Neuroscience 2022Quote: ... Experiments with inducible Cre used 2-20 fmol (10-100 ng) pCAG ERT2-Cre-ERT2 (Addgene #3777, Matsuda and Cepko, 2007) per coverslip ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were seeded at 20% confluence and infected with lentivirus generated from pLentiCRISPRv2 (Addgene #52961, a gift from Feng Zhang (41)) engineered to deliver Cas9 and a gRNA targeting LMAN1 (CCCCTTACACTATAGTGACG) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cas9-mRNA was in vitro transcribed overnight at 20°C from 400-500 ng XbaI-linearized pT3TS-nCas9n (Addgene, plasmid #46757) using the mMessage mMachine T3 Kit (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2024Quote: A CRIPSR guide for the SCN5A E171Q mutation was designed using the CRISPOR online tool.20 We cloned the guide sequence (AATCTTGACCAGAGACTCAA-AGG) into SpCas9-2A-GFP (pX458, Addgene #48138)21 by annealing complementary primers 5’CACCGAATCTTGACCAGAGACTCAA and 5’AAACTTGAGTCTCTGGTCAAGATTC ...
-
bioRxiv - Genetics 2023Quote: ... and VP64 were individually cloned as fusions to rTetR(SE-G72P)20 using the backbone from pJT126 lenti pEF-rTetR(SE-G72P)-3XFLAG-LibCloneSite-T2A-mCherry-BSD-WPRE (Addgene #161926) digested with Esp3I-HF ...
-
bioRxiv - Neuroscience 2022Quote: ... we selected a 20-bp gRNA target sequence that flanked the stop codon and cloned it into pU6-BbsI-chiRNA (Addgene #45946). If the gRNA sequence did not flank the stop codon ...
-
bioRxiv - Developmental Biology 2023Quote: ... along with the appropriate BsmBI recognition sequences (CGTCTCACACCG (sgRNA, 20 nt) GTTTCGAGACG) were added for cloning into the lentiCRISPRv2 (Addgene, #52961) sgRNA and spCas9 expression system ...
-
bioRxiv - Cell Biology 2023Quote: ... NPY-pHluorin (A kind gift from Sebastian Barg, Uppsala), Synaptophysin-pHTomato (A kind gift from Yulong Li lab, China) and mCherry-Lysosomes-20 (Addgene, 55073). Cells were cultured in G418 containing media for 14 days for stable cell line generation.
-
bioRxiv - Synthetic Biology 2024Quote: ... with library plasmid amount corresponding to 1 plasmid per cell and 20 ug of base editor pCMV-T7-ABE8e-nSpCas9-P2A-EGFP (KAC978) (Addgene #185910). Genomic DNA was collected from cells 5 days after transfection.
-
bioRxiv - Microbiology 2021Quote: ... a 20 nucleotide guide RNA (gRNA) sequence targeting the IRF7 protein-coding region was inserted into the lentiCRISPRv2 vector (Addgene; catalog #52961). The IRF7 guide sequences used was ...
-
TSG101 Associates with PARP1 and is Essential for PARylation and DNA Damage-induced NF-κB ActivationbioRxiv - Molecular Biology 2021Quote: ... The lentiCRISPRv2 vectors (30 µg) containing respective guide RNAs were transfected to the cells together with 20 µg of psPAX2 (Addgene, Cat#8454) and 10 µg of pCMV-VSV-G (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ... pLBR08 was generated via Gibson assembly of PCR-amplified LAMP1 cDNA (from mTagRFP-T-Lysosomes-20 acquired from Nikon Imaging Center at UCSF, Addgene plasmid #58022) and PCR-amplified XTEN80-mEGFP-3xHA immunoprecipitation tag with a linearized backbone generated from ClaI and BspDI (New England BioLabs cat ...
-
bioRxiv - Cell Biology 2021Quote: ... Fermentas) of annealed complementary oligonucleotides of the 20-nucleotides target sequences with the pSpCas9(BB)-2A-Puro (PX459) vector (Addgene plasmid #62988) digested with BbsI (BpilI ...
-
bioRxiv - Molecular Biology 2020Quote: Stable Fucci mES cell lines (background 129/Sv/C57BL/C6) were generated for parental and Jarid2 knockout mESCs (20) by transfecting the ES-FUCCI plasmid (34) (Addgene repository #62451). mESCs expressing mCherry:hCdt and Citrine:Geminin were cultured in 5% CO2 at 37 °C on 0.1% gelatin-coated dishes in DMEM KO (Gibco ...
-
bioRxiv - Genetics 2020Quote: ... with 20 ng/μl of dg9 (unc-122p::RFP; red coelomocyte) as a co-injection marker (Addgene #8938; Miyabayashi et al. 1999). Two stable lines of each candidate promoter were selected (Table S1) ...
-
bioRxiv - Neuroscience 2023Quote: ... The oligos pairs encoding the 20-nt guide sequence were annealed and ligated into the pSpCas9(BB)-2A-Puro (PX459) V2.0 vector (Addgene, Watertown, MA, US) and then amplified in chemically competent E ...
-
bioRxiv - Neuroscience 2020Quote: ... a pair of complementary 20 bp oligos for each guide RNA sequence was annealed and cloned into pX330 (Addgene 42230; for guide 1) or pSG (a shuttle vector ...
-
bioRxiv - Cell Biology 2024Quote: ... a PCR-amplified repair template or a synthetic oligo harboring the desired modification flaked by 50-bp homology was co-transformed alongside the bRA89 plasmid bearing Cas9 and the locus-specific 20-bp guide-RNA (from James Haber, Addgene plasmid no. 100950). Ligation of the locus-specific guide-RNA into the bRA89 plasmid was performed for each guide-RNA as previously described54 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 70C for 10 min and 37C for 20 min and introduced into the pSpCas9(BB)-2A-GFP plasmid (Addgene, #48138; Ran et al, 2013) BbsI sites with Golden Gate assembly.