Labshake search
Citations for Addgene :
101 - 150 of 2133 citations for Neutrophil cytosol factor 1 NCF1 Human His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2019Quote: ... TGFB1-bio-His (proTGFβ) which was a gift from Gavin Wright (Addgene plasmid # 52185) [17] and HA-OVOL2 (OVOL2 ...
-
bioRxiv - Cell Biology 2019Quote: ... A plasmid expressing 8X-His-TEV-8X-Arg tag protease was obtained from Addgene and purified according to the published protocol(Tropea et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... V5/His-tagged pLenti-puro-LacZ and pLenti-puro-ARID1A were obtained from Addgene.
-
bioRxiv - Biochemistry 2022Quote: ... pET29b-IPP1-His was a gift from Sebastian Maerkl & Takuya Ueda (Addgene plasmid # 124137). 15µL of Lemo21(DE3 ...
-
bioRxiv - Microbiology 2022Quote: ... coli MG1655 into a His-SUMO-TEV (HST) plasmid backbone (Addgene product number: 48313). Each HST construct was grown in LB to an OD600 of 0.4 at 37°C ...
-
bioRxiv - Synthetic Biology 2022Quote: ... C-terminal His-tagged eGFP plasmid was from our lab stock (Addgene, No. 178422)32 ...
-
bioRxiv - Cell Biology 2023Quote: ... purified from bacteria cells transformed with the plasmid pET-28b-RfxCas13d-His (Addgene 141322), was kindly provided by JP Concordet ...
-
bioRxiv - Biochemistry 2023Quote: GST-HRAS and His/MBP-KRAS were purchased from Addgene (#55653 and # 159546, respectively). GST-KRAS was created with standard Gibson Assembly (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... pGEX6P1-human LIC1 G domain (GST-LIC 1-389) was a gift from Ron Vale (Addgene plasmid # 74598 ...
-
bioRxiv - Biophysics 2020Quote: The DNA of the human kinesin-1 variant devoid of cysteine residue-encoding codons (Addgene #24430) consisted of amino acids 1 to 560 of KIF5B encoding a C-terminal 6xHis-tag[41] ...
-
bioRxiv - Neuroscience 2023Quote: ... pcDNA3.1 Dynamin 1 (human, p880) was a gift from Sandra Schmid and was obtained from Addgene (Addgene plasmid #34682 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Human FUS (residues 1-214) was amplified by PCR using pHR-FUSN-mCh-Cry2WT (Addgene #101223). The IDRs fragments were fused with TPPPCORE domain(aa.45-166 ...
-
bioRxiv - Cell Biology 2022Quote: ... pAAV_hsyn_NES-his-CAMPARI2-F391W-WPRE-SV40 was a gift from Eric Schreiter (Addgene plasmid # 101061)31 ...
-
bioRxiv - Molecular Biology 2020Quote: ... His-tagged wild-type and D135S AlkB plasmids were obtained from Addgene (#79050 and #79051) and proteins were purified by a Ni-NTA column followed by cation exchange ...
-
bioRxiv - Bioengineering 2021Quote: ... We created 2 bacterial expression vectors: pET28-His-MBP-NLS-RfxCas13d-NLS-HA (Addgene 171586) produces the protein RfxCas13d-sTag after cleavage of the N-terminal His-MBP fusion partner ...
-
Enzymatic RNA Biotinylation for Affinity Purification and Identification of RNA-protein InteractionsbioRxiv - Biochemistry 2020Quote: A plasmid encoding obligate dimeric TGT was cloned from the TGT-His plasmid (Addgene #138201) using DNA HiFi Assembly (New England Biolabs ...
-
bioRxiv - Molecular Biology 2021Quote: ... A1AT/ SERPINA1 and PAI1/ SERPINE1 cDNAs were amplified from SERPINA-bio-His plasmid (Addgene #52182) and SERPINE1-bio-his (Addgene #52077 ...
-
bioRxiv - Molecular Biology 2020Quote: ... strains of interest were transformed with a plasmid containing His-tagged SUMO (Smt3-Hisx7) (Addgene) under the control of a copper inducible promoter ...
-
bioRxiv - Cell Biology 2021Quote: ... from the pcDNA3.1 Flag-His-ATM plasmid (kind gift of Michael Kastan; Addgene plasmid #31985) (67 ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmid pET28HIS-hAPE1 (for WT His-APE1 protein) was a gift from Primo Schaer (Addgene plasmid #70757 ...
-
bioRxiv - Pathology 2024Quote: ... BL21(DE3)-RIL Escherichia coli cells were transformed with pJ4M-TDP43-MBP-His (Addgene 104480) and grown on LB/Kanamycin/Chloramphenicol plates then used to inoculate 2L of TB/Kan/Cam/2g dextrose ...
-
bioRxiv - Neuroscience 2023Quote: ... and the injections of AAV5-hSyn-NES-his-CaMPARI2-WPRE-SV40 (2.5x10^12gc/ml Addgene 200nl measured using a Nano Injector ...
-
bioRxiv - Genomics 2020Quote: pNTI729 was constructed by first amplifying the ZEM transcription factor from pNTI638 (pHES795 Addgene #87943) (17 ...
-
bioRxiv - Neuroscience 2021Quote: ... and the Egr1 transcription factor (pcDNA3-Egr1, a gift from Eileen Adamson, Addgene plasmid #11729) known to stimulate the Cav3.2 promotor 25.
-
bioRxiv - Cell Biology 2023Quote: ... Both GFP11-tagged Fluc proteins and GEM transcriptional factor (cloned from pJW1663, Addgene plasmid #112037) were stably integrated into yeast genome ...
-
bioRxiv - Neuroscience 2021Quote: ... under the control of the human synapsin-1 gene promoter (AAV-GFP/Cre, 105540-AAV1, pENN.AAV1.hSyn.HI.eGFP-Cre.WPRE.SV40, Addgene, Massachusetts, USA) or with AAV expressing only GFP (AAV-GFP ...
-
bioRxiv - Cell Biology 2020Quote: Specific shRNA1 and shRNA2 targeting human ARID1A were cloned into the pLKO.1-TRC-puro vector (Addgene), separately ...
-
bioRxiv - Genetics 2020Quote: The plasmid that contains the isoform 1 of human DNMT3B (DNMT3B1) was purchased from Addgene (cat # 35522). The DNMT3B1 cDNA was then fused to an N-terminal Flag tag by PCR ...
-
MANF regulates unfolded protein response and neuronal survival through its ER-located receptor IRE1αbioRxiv - Cell Biology 2020Quote: ... pEZYflag and pEZYmyc-His were a gift from Yu-Zhu Zhang (Addgene plasmids #18700 and #18701). Gateway destination vectors for BiFC for N- and C-terminal tagging with Venus fluorescent protein fragments (pEZY BiFC N NV ...
-
bioRxiv - Biochemistry 2021Quote: ... The His-Sumo bacterial version was codon optimized and cloned into K27-Sumo (Addgene ID 169193) via NEBuilder HiFi DNA Assembly Cloning Kit (NEB) ...
-
bioRxiv - Cell Biology 2021Quote: ... His-Strep2-tag from 438-SNAP-V3 vector a gift from Scott Gradia (Addgene plasmid # 55223) with inserting CATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCAT sequence right in front of Strep II gene by PCR primer ...
-
bioRxiv - Biochemistry 2020Quote: MBP-hnRNPA2 LC, soluble His-tag purification as described (Ryan et al., 2018) (Addgene ID: 98661)
-
bioRxiv - Cell Biology 2019Quote: ... His-tagged SEPT5 plasmid was constructed by PCR amplifying SEPT5 from pCMV-Myc-tagged SEPT5 (Addgene plasmid # 27272 ...
-
bioRxiv - Synthetic Biology 2022Quote: A plasmid construct containing only the maturation protein and his-tagged coat protein dimer (Addgene # 179156) was transformed into Rosetta2™ (DE3 ...
-
bioRxiv - Biochemistry 2022Quote: ... coli and subcloned in-line with his-tagged MBP construct (2CT-10 vector, Addgene plasmid #55209). Recombinant MBP-EndoH fusion was expressed in and purified from E ...
-
bioRxiv - Cancer Biology 2023Quote: SULF2 ORF including C-terminal Myc-His tag was subcloned from its source vector (Addgene # 13003) to lentiviral transfer vector pHR-CMV-TetO2_3C-Twin-Strep (Addgene # 113883 ...
-
bioRxiv - Cell Biology 2023Quote: ... fibroblasts were reprogrammed using lentiviral vectors that carried six transcription factors (ADDGENE/PSIN4-EF2-N2L, ADDGENE/PSIN4-EF2-O2S and ADDGENE/PSIN4-CMV-K2M) ...
-
bioRxiv - Immunology 2020Quote: Soluble human ACE2 with an Fc tag was constructed by PCR amplifying ACE2 (residues 1-615) from Addgene plasmid #1786 (a kind gift from Jesse Bloom ...
-
bioRxiv - Immunology 2022Quote: shRNAs were designed to target human Galectin-9 mRNA and cloned into the pLKO.1 vector (Addgene #10878). The sense shRNA sequences are CCTGGTGCAGAGCTCAGATTT (shGal-9 #1 ...
-
bioRxiv - Cancer Biology 2023Quote: Whole genome CRISPR Screening was performed using the Human CRISPR Knockout Pooled Library (Brunello) - 1 vector system (Addgene and a gift from John Doench to the Functional Genomics Facility at the University of Colorado Anschutz Medical Campus)(44) ...
-
bioRxiv - Neuroscience 2023Quote: The following expression constructs were used: human CaV2.2 (huCaV2.2 (pSAD442-1) was a gift from Diane Lipscombe (Addgene plasmid # 62574 ...
-
bioRxiv - Developmental Biology 2021Quote: ... GST-human β-catenin (Addgene #24193), and NLS-mCherry (Addgene #49313 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pscALPSpuro-HsACE2 (human) (Addgene, MA, USA) were co-transfected with psPAX2 and pCMV-VSV-G packaging plasmids into HEK293T cells using FuGENE 6 (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... human a-SYN (A53T mutant) (Addgene), and mt-Keima (Addgene) ...
-
bioRxiv - Biochemistry 2024Quote: Recombinant human GST-CK2α’ (Addgene #27084) and recombinant human GST-CK2α (Addgene #27083 ...
-
bioRxiv - Cancer Biology 2024Quote: ORF encoding human MARK2 (Addgene, 23404) was cloned into pFL system with an N-terminal Strep2SUMO tag ...
-
Mediobasal hypothalamic FKBP51 acts as a molecular switch linking autophagy to whole-body metabolismbioRxiv - Neuroscience 2021Quote: ... A viral vector containing a Cre expressing cassette (pAAV-CMV-HI-eGFP-Cre-WPRE-SV40, Addgene; #105545) was used to induce Fkbp5 deletion in Fkbp5lox/lox mice ...
-
bioRxiv - Biophysics 2020Quote: ... Two plasmids containing full-length untagged Npl4 and C-terminal His-tagged Ufd1 were purchased from Addgene. Npl4 fragments were expressed in pET-28a vector with an N-terminal His-SUMO tag ...
-
bioRxiv - Biochemistry 2020Quote: hnRNPA2 LC (190-341), insoluble His-tag purification as described (Ryan et al., 2018) (Addgene ID: 98657)
-
bioRxiv - Biochemistry 2022Quote: AR-LBD (663-919) containing an N-terminal His-tag and encoded in pET15b plasmid (Addgene #89083) was expressed in Rosetta (DE3 ...