Labshake search
Citations for Addgene :
101 - 150 of 558 citations for Mouse Thymosin Beta 4 TMSB4X ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... and 1 μg pCXLE-hOCT3/4-shP53 (Addgene #27077) and electroporated using the Neon System (Invitrogen ...
-
bioRxiv - Synthetic Biology 2023Quote: pHB-4 was a gift from Kang Zhou (Addgene plasmid # 140957 ...
-
bioRxiv - Developmental Biology 2021Quote: A mouse Cnr1 cDNA fragment (Addgene, #13391) was cloned into all-in-one tetracycline inducible plasmid (pAS4.1w.Ppuro-aON ...
-
bioRxiv - Cell Biology 2021Quote: ... and mCherry-Climp63(mouse) (Addgene plasmid #136293) were gifts from Gia Voeltz36 ...
-
bioRxiv - Neuroscience 2023Quote: ... and pCDNA3-mouse PKA-RIIalpha-mEGFP (Addgene plasmid # 45527 ...
-
bioRxiv - Biochemistry 2020Quote: ... anti-mouse IgG AlexaFluor-488 (Life Technologies A11029-EA. The following plasmids were used: mouse PM20D1-flag (Addgene 84566). pENN.AAV.tMCK.PI.eGFP.WPRE.bGH (Addgene 105556) ...
-
bioRxiv - Neuroscience 2020Quote: [4] T2A-GCaMP6s from pGP-CMV-GCaMP6s (Addgene plasmid #40753) with T2A sequence includedintheforwardprimer(underlined ...
-
bioRxiv - Neuroscience 2020Quote: ... two unc-4 sgRNA plasmids and Cas9 plasmid (Addgene #46168) (Friedland et al. ...
-
bioRxiv - Immunology 2022Quote: ... Cells were transfected with 4 mg of SNAP-CD59 (Addgene) using Lipofectamine 3000 (Life Technologies) ...
-
bioRxiv - Genomics 2022Quote: ... 4 µg of the envelope-encoding plasmid pVSVg (Addgene 12260) and 7.5 µg of the packaging plasmid psPAX2 (Addgene 8454 ...
-
bioRxiv - Neuroscience 2023Quote: ... and 4 μg of envelope plasmid (pMD2.G; Addgene #12259) with 112 μg PEI MAX (Polysciences ...
-
bioRxiv - Cell Biology 2023Quote: ... and 4 µg of the viral packing PsPAX (Addgene #12260) plasmids using the Polyfect reagent according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The YTK kit (Addgene; Kit #1000000061) was used as a source for all relevant non-coding DNA sequences — including promoters and terminators ...
-
bioRxiv - Immunology 2022Quote: HEK293A cells stably expressing mouse NLRP3 (Addgene 75127), and ASC-GFP (Addgene 73957 ...
-
bioRxiv - Neuroscience 2021Quote: ... plus empty pEGFP and mouse neuroligin-1B (Addgene #15261 ...
-
bioRxiv - Cell Biology 2021Quote: ... The generation of mouse myc-Bnip3 (Addgene #100796) was described previously 48 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse GeCKOv2 CRISPR knockout pooled library (Addgene #1000000053,18), pMD2.G and psPAX2 were transfected into Lenti-X 293T cells ...
-
bioRxiv - Genetics 2021Quote: ... or the catalytic domain (CD) of mouse Dnmt3a and the C-terminal part of mouse Dnmt3L (3a3L) (amplified from pET28-Dnmt3a3L-sc27 (Addgene #71827)) and cloned in PiggyBac plasmids under control of the TRE3G promoter ...
-
bioRxiv - Developmental Biology 2021Quote: The mouse Trim41 cDNA (ENSMUST00000047145) tagged with PA and 1D4 was inserted under the control of the mouse Clgn promoter (Addgene #173686) (Ikawa et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... two independent sgRNA against mouse Chk2 (GTATACATAGAGGATCACAG and GCTGGAGACAGTGTCTACCC) or mouse Trp53 (56) were cloned into pKLV-U6gRNA(BbsI)-PGKpuro2ABFP (Addgene, 50946). Lentiviral packaging plasmids (1µg pCMV-Rev ...
-
bioRxiv - Molecular Biology 2023Quote: Polymerase chain reaction (PCR) was used to isolate mouse AMPKγ1 cDNA from a mouse AMPKγ1-HA vector (#40605, Addgene, Watertown, MA, USA). Mouse AMPKγ1 cDNA was then cloned into the 3xFLAG-CMV10 vector (Sigma-Aldrich ...
-
bioRxiv - Synthetic Biology 2022Quote: ... MoClo Plant Parts Kit (Addgene Kit #1000000047), GreenGate Cloning System (Addgene Kit #1000000036 ...
-
bioRxiv - Neuroscience 2021Quote: ... 4 μg of the second-generation packaging plasmid psPAX2 (Addgene; 12260), and 2 μg of viral entry protein VSV-G plasmid pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2019Quote: MEFs were transfected with 4 μg of 8xGTIIC-luciferase (Addgene, #34615), SBE2-luciferase (Addgene ...
-
bioRxiv - Genetics 2020Quote: ... Gal80 coding sequence was PCR amplified from pBPGAL80Uw-4 (Addgene 26235). A His2Av polyA sequence after the BFP/Gal80 coding sequence was PCR amplified from pDEST-HemmarR2 (Addgene # 112813).
-
bioRxiv - Neuroscience 2020Quote: ... AAV8-hSyn-DIO-hM3-mCherry (4×1012 vg/ml, Addgene 44362), AAV8-hSyn-hM4-mCherry (6×1012 vg/ml ...
-
bioRxiv - Genetics 2020Quote: ... Gal80 coding sequence was PCR amplified from pBPGAL80Uw-4 (Addgene 26235) using the oligonucleotides aaaaaaaaatcaaaATGAGCGGTACCGATTACAACAAAAGGAGTAGTGTGAG and GCCGACTGGCTTAGTTAattaattctagaTTAAAGCGAGTAGTGGGAGATGTTG ...
-
bioRxiv - Neuroscience 2023Quote: ... WPRE.SV40 virus (titer: 4 × 1013 GC per ml, obtained from Addgene) was lowered to a depth of 2.4 mm below the dura ...
-
bioRxiv - Cell Biology 2022Quote: ... and mCherry-Snx9 (#27678) (all mouse) were from Addgene.
-
bioRxiv - Neuroscience 2020Quote: ... Postsynaptic mouse neuroligin-1 was PCR amplified from Addgene #15260 ...
-
bioRxiv - Biophysics 2023Quote: ... mouse Opa1 sequence was cloned into pR26-CMVconst (Addgene plasmid #127373 ...
-
bioRxiv - Genetics 2024Quote: Mouse CRISPR Brie lentiviral pooled library (Addgene Plasmid # 170511) consisting of 79,637 gRNAs was co-transfected with packaging plasmids (psPAX2 and pMD2.G ...
-
bioRxiv - Neuroscience 2020Quote: ... the fibroblasts were reprogrammed using the three plasmids (pCXLE-hOct3/4 [Addgene #27076] ...
-
bioRxiv - Cell Biology 2020Quote: ... The cells were transfected with 4 μg of pMD2.G (Addgene #12259), 4 μg of psPAX2 (Addgene #12260 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and pMD2G envelope plasmid (4 µg, a gift from Didier Trono; Addgene plasmid #12259 ...
-
bioRxiv - Neuroscience 2023Quote: ... we used AAV2/9-pAAV-hDlx-hM3Dq-dTomato-Fishell-4 (Addgene, 83897) and AAV2/9-pAAV-hDlx-hM4Di-dTomato-Fishell-5 (Addgene ...
-
bioRxiv - Systems Biology 2023Quote: ... and pMD2G envelope plasmid (4 μg, a gift from Didier Trono (Addgene plasmid #12259 ...
-
bioRxiv - Immunology 2023Quote: BMDMs grown on 4-well chamber were transfected with GEM-CEPIA1er (Addgene) (Suzuki et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 μg of each plasmid pCXLE-hOCT3/4-shp53-F (Addgene #27077), pCXLE-hSK (Addgene #27078) ...
-
bioRxiv - Microbiology 2023Quote: ... 6 µg of 4:2:1:1 transfer:Gag-Pol (pMDLg-pRRE, Addgene):Rev (pRSV-Rev ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse Lhx2 cDNA was amplified from TetO-FUW-Lhx2 (Addgene #61537 ...
-
bioRxiv - Cell Biology 2022Quote: Mouse Drp1 was PCR amplified from pcDNA3.1 mDrp1 (Addgene #34706) and cloned into pLenti BlastR using InFusion cloning ...
-
bioRxiv - Cell Biology 2021Quote: The pcDNA 3.1 (-) mouse C/EBPδ expression vector (AddGene, #12559) and annealed oligonucleotides (Supplementary Table S4 ...
-
bioRxiv - Biophysics 2023Quote: ... Mouse TRPM5 in pcDNA3.1 was purchased from Addgene (plasmid #85189), human TRPM5 in pcDNA3.1+ (Accession No ...
-
bioRxiv - Molecular Biology 2023Quote: ... untagged mouse cDNA into a pBig1a vector70 (Addgene, Plasmid #80611). These untagged RING1B and BMI1 constructs were used for all experiments presented in this manuscript with the exception for the data presented in Figure 6C ...
-
bioRxiv - Molecular Biology 2024Quote: Mouse Two Plasmid Activity-Optimized CRISPR Knockout Library (Addgene#1000000096) was amplified in E coli ...
-
bioRxiv - Cancer Biology 2024Quote: The mouse GeCKO v2 library was obtained from Addgene (#1000000052). LentiCRISPRv2 is a one-vector plasmid system for the mouse GeCKO (Genome-scale CRISPR Knockout ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 μg of packaging vector psPAX2 (gift from Didier Trono (Addgene plasmid # 12260)) ...
-
bioRxiv - Molecular Biology 2020Quote: ... was mixed with 4 μg of DNA RV helper plasmid (Addgene, plasmid #12371), in 1800 μl of Opti-MEM reduced serum medium (ThermoFisher ...
-
bioRxiv - Physiology 2021Quote: ... 200nL AAV-hM3D(G)q-mCherry (Addgene 44361-AAV8, 4×1012 vg/mL) was injected bilaterally at 50nl/min and mice were allowed 2 weeks recovery prior to testing ...