Labshake search
Citations for Addgene :
101 - 150 of 804 citations for Mouse Mesoderm Specific Transcript Protein MEST ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: A pair of oligos containing the gRNA sequence were used in conjunction with vector-specific primers (Table S1) for PCR amplification of Medicago truncatula U6 promoter and scaffold from the pUC-gRNA plasmid (Addgene #47024) using Q5® High-Fidelity 2X Master Mix (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... The online oligo design tool www.pcr-tagging.com was used for searching PAM sites and to design the forward (M1) and reverse (M2) tagging oligos specific for enAsCas12a (Addgene #107942). M1 and M2 oligos ...
-
bioRxiv - Developmental Biology 2023Quote: A sgRNA targeting the patient-specific mutation in SYNGAP1 was cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid #62988). This ...
-
bioRxiv - Neuroscience 2021Quote: ... or KH1*KH2* mutants were PCR amplified from their respective pAc5.1B-EGFP vector and cloned into the HindIII and EcoRI sites of the pAc5.1-lambdaN-HA vector (a gift from Elisa Izaurralde; Addgene plasmid #21302) (Behm-Ansmant et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... was PCR amplified and cloned downstream of EGFP in the pAc5.1B-EGFP vector (a gift from Elisa Izaurralde; Addgene plasmid #21181) using the HindIII and EcoRI restriction sites to make pAcB5.1-EGFP-FMRP ...
-
Hippocampal efferents to retrosplenial cortex and lateral septum are required for memory acquisitionbioRxiv - Neuroscience 2020Quote: ... enhanced yellow fluorescent protein (eYFP) or enhanced green fluorescent protein (eGFP): AAV1.CaMKIIa.eNpHR3.0.eYFP.WPRE.hGH (Addgene, #26971), AAV1.CaMKII.eYFP ...
-
bioRxiv - Synthetic Biology 2022Quote: A plasmid construct containing only the maturation protein and his-tagged coat protein dimer (Addgene # 179156) was transformed into Rosetta2™ (DE3 ...
-
bioRxiv - Genomics 2019Quote: ... we cloned effector proteins (PguCas13b: Addgene 103861 ...
-
bioRxiv - Genetics 2019Quote: ... Cas9 protein and mRNA (44758; Addgene) were co-microinjected into zygotes [F1 hybrids between strains FVB/NJ and B6(Cg)-Tyrc-2J/J] using the reagent concentrations listed in Table S1 ...
-
bioRxiv - Bioengineering 2021Quote: ... the Spike protein (Addgene plasmid # 145032) was cloned downstream of the TRE3G promoter ...
-
bioRxiv - Bioengineering 2021Quote: ... We acquired psPAX2 encoding lentiviral packaging proteins and PMD2.G encoding a lentiviral envelop protein from Addgene (plasmid no ...
-
bioRxiv - Cell Biology 2020Quote: WT and JMS hiPSCs were transduced with lentiviruses encloding for the non-specific control short-hairpin RNA (shControl; pLKO.1 puro (Addgene ID: 8453)) or the p53 targeting shRNA (shp53 pLKO.1 puro shRNA (Addgene ID ...
-
bioRxiv - Neuroscience 2019Quote: ... and pCAG-double floxed-SYP-eGFP-WPRE were generated by subcloning original constructs and then customized into specific promoters (available in Addgene for distribution). Plasmids were delivered through in utero electroporation as previously described (51 ...
-
bioRxiv - Developmental Biology 2022Quote: ... as well as a lens-specific crystallin promoter upstream of mCherry (iTol2Amp-γ-crystallin:RFP, a gift from Nadia Mercader Huber; Addgene plasmid # 108455)71 ...
-
bioRxiv - Neuroscience 2022Quote: ... JEDI-1P was cloned into pAAV vector under the control of the neuron-specific hSyn promoter by replacing the ASAP2s sequence in pAAV-hSyn-ASAP2s (Addgene plasmid #101276). pAAV-hSyn vector was linearized with restriction enzymes KpnI and HindIII.
-
bioRxiv - Biochemistry 2023Quote: ... and the 6xHis-SUMO tag was removed by enzymatic cleavage using human Sentrin-specific protease 1 (SENP1) catalytic domain (derived from pET28a-HsSENP1, that was a gift from Jorge Eduardo Azevedo (Addgene plasmid #71465) at 4°C overnight27,28 ...
-
bioRxiv - Neuroscience 2019Quote: ... recombinant mouse E1 (Addgene plasmid # 32534), E2 (pGEX4T-1-UbcH5b) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Mouse Ddx5 WT(Addgene plasmid #88869) and Lys144 to Asn mutant(Addgene plasmid #88870 ...
-
bioRxiv - Neuroscience 2022Quote: ... and mouse IgG1 Fc (Addgene #28216) and IgG2a Fc (Addgene #114492) ...
-
bioRxiv - Neuroscience 2023Quote: ... pCDNA3-mouse PKA-RIalpha-mEGFP (Addgene plasmid # 45525 ...
-
bioRxiv - Neuroscience 2023Quote: ... pcDNA3-mouse PKA-RIbeta-mEGFP (Addgene plasmid # 45526 ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmids pLVX-EF1alpha-SARS-CoV-2-proteins-2xStrep-IRES-Puro proteins are a gift from Nevan Krogan (Addgene)(Gordon ...
-
bioRxiv - Cell Biology 2024Quote: ... a PCR-amplified repair template or a synthetic oligo harboring the desired modification flaked by 50-bp homology was co-transformed alongside the bRA89 plasmid bearing Cas9 and the locus-specific 20-bp guide-RNA (from James Haber, Addgene plasmid no. 100950). Ligation of the locus-specific guide-RNA into the bRA89 plasmid was performed for each guide-RNA as previously described54 ...
-
bioRxiv - Genomics 2019Quote: ... we cloned the effector proteins (PguCas13b: Addgene 103861 ...
-
bioRxiv - Molecular Biology 2020Quote: ... envelope protein plasmid (pMD2.G, Addgene #12259), REV-expressing plasmid (pRSV-Rev ...
-
bioRxiv - Cell Biology 2021Quote: ... and envelope encoding protein (VSVG; Addgene # 8454). Lentiviral particles were collected after 48 hrs of transfection and were used for transducing target cell lines.
-
bioRxiv - Cell Biology 2020Quote: ... or a fluorescent protein (pCDNA3-GFP; Addgene plasmid #74165 or mCherry2-N1 ...
-
bioRxiv - Biochemistry 2023Quote: ... and YFP tagged recombinant proteins (Addgene #173080), genes were inserted between N-terminal 6x His-tag followed by CFP/YFP tag and a TEV protease cleavage site of pNIC28-Bsa4 ...
-
bioRxiv - Biochemistry 2024Quote: ... envelope protein-pCMV-VSV-G (Addgene #8454), packaging plasmid - pCMV-dR8.2 dvpr (Addgene #8455 ...
-
bioRxiv - Developmental Biology 2021Quote: A mouse Cnr1 cDNA fragment (Addgene, #13391) was cloned into all-in-one tetracycline inducible plasmid (pAS4.1w.Ppuro-aON ...
-
bioRxiv - Cell Biology 2021Quote: ... and mCherry-Climp63(mouse) (Addgene plasmid #136293) were gifts from Gia Voeltz36 ...
-
bioRxiv - Neuroscience 2023Quote: ... and pCDNA3-mouse PKA-RIIalpha-mEGFP (Addgene plasmid # 45527 ...
-
bioRxiv - Neuroscience 2022Quote: ... the truncated human astrocyte-specific promoter hGfaABC1D (54) was digested from pAAV-GFAP-EGFP (donated by Dr. Bryan Roth, Addgene Plasmid #50473; RRID #Addgene_50473) and cloned into pAAV-EF1a-DIO-hM4D(Gi)-mCherry (donated by Dr ...
-
bioRxiv - Immunology 2021Quote: The SARS-CoV-2 pseudoviral particles expressing COVID-19 spike protein pGBW m4137384: S protein was purchased from Addgene (149543) and the virus particles were produced as describe previously (Hoffmann et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... Ras GTPase-activating protein-binding protein 1 (G3BP1) phage UbiC G3BP1-GFP-GFP was a gift from Jeffrey Chao (Addgene plasmid # 119950 ...
-
bioRxiv - Biochemistry 2020Quote: ... anti-mouse IgG AlexaFluor-488 (Life Technologies A11029-EA. The following plasmids were used: mouse PM20D1-flag (Addgene 84566). pENN.AAV.tMCK.PI.eGFP.WPRE.bGH (Addgene 105556) ...
-
bioRxiv - Systems Biology 2021Quote: ... and envelope protein pCMV-VSV-G (Addgene #8454) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and pBAD expressing fluorescent protein variants (Addgene, UK). Primers used in the assembly of the vectors are listed in SI Table 1.
-
bioRxiv - Biophysics 2022Quote: Fluorescent proteins were obtained from Addgene (https://www.addgene.org/) transfected using 0.2 ug plasmid DNA ...
-
bioRxiv - Physiology 2022Quote: ... EGFP-DCTN1 fusion protein (Addgene pEGFP-p150Glued, #36154) or tdTomato-EB3 fusion protein (Addgene ...
-
Efficient CRISPR/Cas9 genome editing in a salmonid fish cell line using a lentivirus delivery systembioRxiv - Genetics 2019Quote: ... Specific gRNA for EGFP and RIG-I (Table2, underlined) were cloned according to Golden Gate reaction from ZhangLab protocol (Addgene SAM library sgRNA cloning protocol) using BbsI-HF (NEB ...
-
bioRxiv - Immunology 2023Quote: Pseudovirus expressing Wuhan-Hu-1 SARS-CoV-2 S protein were produced by co-transfection of plasmids encoding a GFP protein (Addgene, 11619), a lentivirus backbone (VRC5602 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The YTK kit (Addgene; Kit #1000000061) was used as a source for all relevant non-coding DNA sequences — including promoters and terminators ...
-
bioRxiv - Immunology 2022Quote: HEK293A cells stably expressing mouse NLRP3 (Addgene 75127), and ASC-GFP (Addgene 73957 ...
-
bioRxiv - Neuroscience 2021Quote: ... plus empty pEGFP and mouse neuroligin-1B (Addgene #15261 ...
-
bioRxiv - Cell Biology 2021Quote: ... The generation of mouse myc-Bnip3 (Addgene #100796) was described previously 48 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse GeCKOv2 CRISPR knockout pooled library (Addgene #1000000053,18), pMD2.G and psPAX2 were transfected into Lenti-X 293T cells ...
-
bioRxiv - Genetics 2021Quote: ... or the catalytic domain (CD) of mouse Dnmt3a and the C-terminal part of mouse Dnmt3L (3a3L) (amplified from pET28-Dnmt3a3L-sc27 (Addgene #71827)) and cloned in PiggyBac plasmids under control of the TRE3G promoter ...
-
bioRxiv - Developmental Biology 2021Quote: The mouse Trim41 cDNA (ENSMUST00000047145) tagged with PA and 1D4 was inserted under the control of the mouse Clgn promoter (Addgene #173686) (Ikawa et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... two independent sgRNA against mouse Chk2 (GTATACATAGAGGATCACAG and GCTGGAGACAGTGTCTACCC) or mouse Trp53 (56) were cloned into pKLV-U6gRNA(BbsI)-PGKpuro2ABFP (Addgene, 50946). Lentiviral packaging plasmids (1µg pCMV-Rev ...