Labshake search
Citations for Addgene :
101 - 150 of 843 citations for Mouse Anti Hepatitis B Virus E Antigen Antibody 1894 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: ... membrane and envelope (CoV2-M-IRES-E, Addgene), and spike (nCoV-2-B117 or B117/M1237I ...
-
bioRxiv - Cell Biology 2021Quote: Lig4-/- or Lig4-/-:Lin37-/- abl pre-B cells were transduced with lentiviral mouse genome-wide CRISPR gRNA library V2 (Addgene #67988) by centrifuging a cell and viral supernatant mixture (supplemented with 5μg/ml polybrene ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 3 µg pBABE-neo largeT antigen cDNA (Addgene, 1780 ref (16))using lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Bioengineering 2020Quote: ... The antigen-binding fragments (Fab) were cloned into pHLSec vector (Addgene, #99845) using AgeI and XhoI restriction sites ...
-
bioRxiv - Biochemistry 2024Quote: ... The SV40 Large T antigen and HA-TRIM71 were purchased from Addgene (plasmid # 136616 and #52717 ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.7-1 μL of virus (AAV2-CMV-mCreb, 1×1012 Addgene Plasmid #68551 ...
-
bioRxiv - Cancer Biology 2019Quote: Virus rich media (VRM) of the Cas9-Blast plasmid (Addgene: #52962) was infected into regular AML lines using the standard lentivirus infection protocol described below ...
-
bioRxiv - Neuroscience 2019Quote: ... Pseudotyped rabies virus (SAD B19 strain, EnvA-RbV-GFP, Addgene# 52487) was commercially obtained from the Janelia Viral Tools Facility stored at −80°C ...
-
bioRxiv - Neuroscience 2021Quote: ... or a control virus (AAV5-hSyn-DIO-EGFP; Addgene, 50457-AAV5) targeting the CeA ...
-
bioRxiv - Neuroscience 2022Quote: ... GCaMP6s virus (AAV-DJ-Ef1a-DIO-GCaMP6s) was obtained from Addgene, Tet-tox virus (AAV-CBA-DIO-GFP-TetTox-WPRE-bHGpA ...
-
bioRxiv - Neuroscience 2020Quote: pAAV.Syn.GCaMP6f.WPRE.SV40 virus (titer: 2.2 × 1013 GC/mL, obtained from AddGene, USA) was injected into dorsal hippocampus (AP -2.1 ...
-
bioRxiv - Neuroscience 2021Quote: The adenoassociated virus (AAV) pAAV2/9.CAG.FLEX.GCaMP6s.WPRE.SV40 was purchased from Addgene (Addgene viral prep #100842-AAV9 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 0.5 μL AAV pCAG-FLEX-EGFP-WPRE virus (Addgene, Cambridge, MA) was injected into the NTS ...
-
bioRxiv - Immunology 2020Quote: ... and a murine leukemia virus (MLV) Gag-Pol plasmid (Addgene # 14887) were purified using the Endo-Free Plasmid Maxi Kit (Qiagen ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV-hSyn-DIO-GCaMP7f-WPRE (AAV9 virus) are from Addgene.
-
bioRxiv - Neuroscience 2022Quote: ... the adeno-associated virus AAV1.CAG.FLEX.tdTomato.WPRE.bGH (#59462, Addgene, Watertown, MA, USA) was used ...
-
bioRxiv - Neuroscience 2023Quote: ... Virus (AAV1.syn.jGCaMP7s.WPRE.SV40 from Addgene, lot v50167, titer 2.7E13 GC/mL) was then injected at 2 sites within the durotomy ...
-
bioRxiv - Neuroscience 2023Quote: ... WPRE.SV40 virus (titer: 4 × 1013 GC per ml, obtained from Addgene) was lowered to a depth of 2.4 mm below the dura ...
-
bioRxiv - Cell Biology 2023Quote: ... U2OS cells were transduced with virus containing lentiCas9-Blast (Addgene, #52962). Cells were then treated with 5 µg/mL blasticidin for 5 days to make a stable population of U2OS-Cas9 cells ...
-
bioRxiv - Neuroscience 2023Quote: ... or control virus AAV-hSyn-EYFP (AddGene, 50465-AAV2, Watertown MA) into the CeA (−1.17 mm AP ...
-
bioRxiv - Neuroscience 2023Quote: ... and a cre-dependent virus (AAV9-DIO-Ef1a-eYFP, Addgene #27056) were used.
-
bioRxiv - Cell Biology 2023Quote: ... transduced with recombinant adeno-associated virus (rAAV) (Addgene, pAAV TBG FFLuc) supernatant ...
-
bioRxiv - Neuroscience 2023Quote: ... 2.5 mm V) and retrograde AAV-Syn-jGCaMP8f-WPRE virus (Addgene) was injected using a Nanoject ...
-
bioRxiv - Neuroscience 2023Quote: ... retroAAV-CAG-GFP (virus made in the host institute, using Addgene plasmid #37825 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cre or GFP expressing adeno-associated virus (GFP pAAV.CMV.PI.EGFP.WPRE.bGH, Addgene 105530; Cre pENN.AAV.CMVs.PI.Cre.rBG, Addgene 105537) were bilaterally injected into the mPFC of AT2R-flox mice at 2.5mm caudal ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were transduced with virus expressing dCas9-VP64 (Addgene, Watertown, MA), selected using blasticidin (6 – 10 µg/ml ...
-
bioRxiv - Cell Biology 2024Quote: ... Specific gRNAs against mouse Cyri-b (ex3: CACCGGGTGCAGTCGTGCCACTAGT) were cloned into the sPs-U6-gRNA-Cas9 (BB)-2A-GFP vector (Addgene Plasmid #48138) (Ran et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... are a derivative of HEK293T-E with a second-generation lentiviral vector generated with the pCW57-E-IRES-ORF6 (Addgene plasmid #80921) as a transfer vector ...
-
bioRxiv - Immunology 2024Quote: ... MEFs were transfected with SV40 small+large T antigen-expressing plasmid (22298, Addgene) using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Neuroscience 2021Quote: ... E Dent include the plasmids EB3 tdTomato (Addgene #50708) and the plasmid encoding DsRed2 (Clontech) ...
-
bioRxiv - Developmental Biology 2021Quote: ... The plasmid E[beta]C (Addgene cat. no. 24312) was used ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV-Cag-Egfp-Apobec1-Yth (E-Yth, Addgene #209319), pAAV-Cag-Egfp-Apobec1-Ythmut(E-Ythmut ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV-Cag-Apobec1-Ythmut-Egfp (Ythmut-E, Addgene #209323), pAAV-Cag-Apobec1-Egfp (Addgene #209324 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV-Cag-Egfp-Apobec1-Ythmut(E-Ythmut, Addgene #209320) and pAAV-Cag-Egfp-Apobec1 (Addgene #209321) ...
-
bioRxiv - Neuroscience 2022Quote: ... or control virus pAAV-CaMKIIa-EGFP (Addgene Cat# 50469-AAV5, titer: 4.3x1012) into the CA2 using the following coordinates from Bregma ...
-
bioRxiv - Neuroscience 2021Quote: ... The control virus (AAV8-hSyn-DIO-mCherry, 2.3×1013 GC/mL, Addgene) was injected according to the same procedure ...
-
bioRxiv - Biochemistry 2021Quote: Tobacco Etch Virus protease (TEV) was a gift from Helena Berglund (Addgene plasmid # 125194 ...
-
bioRxiv - Neuroscience 2022Quote: ... a virus expressing GCaMP6s (AAV9.Syn.GCaMP6s.WPRE.SV40, ~1.9 × 1013 GC/ml; Addgene # 100843) was injected unilaterally in the A13 while for DREADD experiments viruses for reversibly activating (AVV8-Syn-hM3D-Gq-mCherry ...
-
bioRxiv - Neuroscience 2019Quote: ... or AAV5-hDlx-GqDREADD-dTomato (3.15×10^15 virus molecules/mL) (Addgene plasmid # 83897 ...
-
bioRxiv - Neuroscience 2019Quote: ... Virus (1012 titer; AAV2/2 camKII-KV2.1-ChrimsonR-FusionRed; Addgene, plasmid #102771) was injected 400 μm below the dura (4-10 sites ...
-
bioRxiv - Neuroscience 2020Quote: ... 1.2 ul of AAV8-hSyn-DIO-hM4D(Gi)-mCherry virus (Addgene, USA) were bilaterally injected into 6 PV-Cre animals bilaterally ±0.5 mm lateral to midline ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.5μl pGP-AAVrg-syn-jGCaMP7f-WPRE virus 25 (1.85× 1013GC/ml; Addgene) was infused into the NAc (A/P ...
-
bioRxiv - Neuroscience 2022Quote: ... the virus used was an AAV5-FLOX-ChR2-mCherry (Addgene, #20297-AAV5) or a AAV5-Ef1a-DIO-eYFP (UNC Vector Core) ...
-
bioRxiv - Immunology 2023Quote: ... Fresh virus of (MSCV-myc-CAR-2A-Thy1.1, Anjana Rao, Addgene: 127890) containing chimeric antigen receptor (CAR ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 µl of AAV9.CAG.GCaMP6s.WPRE.SV40 or AAV9.syn.GCaMP8s-WPRE virus (Addgene, USA) was injected subcutaneously in the nape of the neck ...
-
bioRxiv - Genetics 2023Quote: Library plasmid pools were packaged into lenti-virus by PsPAX2 (Addgene 12260) and pMD2.G (Addgene 12259 ...
-
bioRxiv - Neuroscience 2023Quote: ... Virus (AAV1-S5E2-jGCaMP6f; Addgene #135632-AAV1; diluted 1:3 in saline) was injected into the RSC (AP ...
-
bioRxiv - Neuroscience 2023Quote: ... a 1 μL dot of AAV9/hSyn/GCaMP6f virus (Addgene, Watertown, MA) diluted 1-5x from commercial titer (2.8x1013 to ∼1x1012 units/mL ...
-
bioRxiv - Neuroscience 2023Quote: ... an AAV retrograde virus expressing pAAV-hSyn-hM4D(Gi)-mCherry (Addgene #50475) or pAAV-hSyn-hM3D(Gq)-mCherry (Addgene #50474 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The virus package plasmids psPAX2 and pMD2.G were purchased from Addgene. To produce the lentivirus ...