Labshake search
Citations for Addgene :
101 - 150 of 387 citations for Mouse Anti Hepatitis B Surface Antigen Antibody 1834 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... the DNA sequence encoding hPMCA2w/b was PCR amplified from pZac2.1-GfaABC1D-mCherry-hPMCA2w/b (a gift from Baljit Khakh (Addgene plasmid # 111568 ; http://n2t.net/addgene:111568 ; RRID:Addgene_111568) with primers designed to incorporate a N-terminal HA tag encoding the amino acids YPYDVPDYA and used to replace mCherry-PMCA2w/b in the same backbone at the 5’ NheI and 3’ XbaI restriction sites using the NEBuilder Hifi DNA assembly kit ...
-
bioRxiv - Molecular Biology 2019Quote: ... HSP104-b/Leu(WT) was a gift from Susan Lindquist (Addgene plasmid # 1156; http://n2t.net/addgene:1156; RRID:Addgene_1156) (Schirmer et al ...
-
bioRxiv - Molecular Biology 2021Quote: ... RBM39 wt and variants were cloned into the Artichoke reporter plasmid (a gift from B. Ebert, Addgene 73320) using Golden Gate cloning.
-
bioRxiv - Biochemistry 2023Quote: ... as described in Janecek et al.39 Aurora B protein was expressed from plasmid pNIC28-AurB (Addgene 39119).
-
bioRxiv - Plant Biology 2023Quote: ... as well as the B-module with mNeonGreen (amplified from an AddGene-derived template (Shaner et al., 2013)) and the C-module with LTI6b (amplified from total cellular A ...
-
bioRxiv - Cell Biology 2024Quote: B16-F1 cells were transiently transfected with CYRI-B-p17-GFP and mCherry-β1 integrin (Addgene plasmid #55064) and plated on laminin coated glass bottom dishes ...
-
bioRxiv - Biochemistry 2024Quote: ... It was cloned into 438-B vector (kind gift from Scott Gradia; Addgene plasmid # 55219; http://n2t.net/addgene:55219; RRID:Addgene_5521982) in frame with an N-terminal 6xHis tag followed by a TEV cleavage site ...
-
bioRxiv - Molecular Biology 2021Quote: ... and firefly luciferase control (FLuc) were generated by subcloning FLuc-5Xbox b from plasmid pAc5.1C-Fluc-STOP-5boxb (Addgene) into pcDNA3.1(+ ...
-
bioRxiv - Cell Biology 2019Quote: ... Cas9 guide RNA sequences were identified using the website crispr.mit.edu (guide A: gTCCCCGCAAGAGTAGTAAT; guide B: gGTCTCACAGACCGTAAGTT) and inserted into plasmid pX335 (a gift from Feng Zhang, Addgene, 42335). HeLa Kyoto cells (Landry et al. ...
-
bioRxiv - Molecular Biology 2021Quote: HeLa cells were transduced overnight at a MOI of 0.4 with a pooled genome-wide CRISPR KO (GeCKO v2) library A or B (Addgene) containing a total of 122,411 sgRNAs (6 sgRNAs per gene ...
-
bioRxiv - Cell Biology 2023Quote: Human genome targeting CRISPR Knock-Out (GeCKO) v2 lentiviral pooled libraries (A and B libraries) were purchased from Addgene and amplified according to a published protocol (Sanjana et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... was designed to target the regions close to the start codon (Figure 1A,B) and the sgRNA sequence was inserted into the pX459 V2.0 plasmid (#62988, Addgene). The reference plasmids containing PA tag sequence were constructed in pBluescript II SK (+ ...
-
bioRxiv - Cancer Biology 2023Quote: ... IL1R1 sgRNA was custom designed against IL1R1 promoter G-quadruplex (G4-motif B) and cloned in pX333 (Addgene 64073) backbone after replacing Cas9 with mCherry.
-
bioRxiv - Neuroscience 2019Quote: ... recombinant mouse E1 (Addgene plasmid # 32534), E2 (pGEX4T-1-UbcH5b) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Mouse Ddx5 WT(Addgene plasmid #88869) and Lys144 to Asn mutant(Addgene plasmid #88870 ...
-
bioRxiv - Neuroscience 2022Quote: ... and mouse IgG1 Fc (Addgene #28216) and IgG2a Fc (Addgene #114492) ...
-
bioRxiv - Neuroscience 2023Quote: ... pCDNA3-mouse PKA-RIalpha-mEGFP (Addgene plasmid # 45525 ...
-
bioRxiv - Neuroscience 2023Quote: ... pcDNA3-mouse PKA-RIbeta-mEGFP (Addgene plasmid # 45526 ...
-
bioRxiv - Molecular Biology 2021Quote: 144 million Lig4-/- abl pre-B cells were transduced with a viral tet-inducible guide RNA library (Pooled Library #67988, Addgene) containing 90,000 gRNAs targeting over 18,000 mouse genes ...
-
bioRxiv - Bioengineering 2021Quote: ... the U6.3-gRNATraB fragment was PCR amplified from the sgRNATra-B plasmid using primers 2XgRNA-5F and 2XgRNA-6R and was cloned into the sgRNAβTub plasmid (Addgene #112691). To build the TI-pgSITsxl,βTub,Hsp-Cas9 and TI-pgSITTraB,βTub,Hsp-Cas9 constructs (Supplementary Fig ...
-
bioRxiv - Cell Biology 2021Quote: ... NANOG and PRDM14 (see Table 1) were cloned into pLentiCRISPR V2 vectors with puro (SOX2, NANOG) or hygromycin B (PRDM14) resistance (Addgene plasmids #52961 and #98291 respectively ...
-
bioRxiv - Microbiology 2021Quote: The plasmids coding GeCKO sub-libraries A and B were amplified and prepared according to the provided guidelines (Lentiviral Crispr Toolbox, Addgene). 60 million T98G/Cas9 cells were transduced with GeCKO LVs at a MOI of 0,1 to cover about 100-times the half-library complexity ...
-
bioRxiv - Cell Biology 2021Quote: ... and non-targeted Suv420-GFP was achieved by cloning the respective cDNA into Addgene vector CENP-B DBD INCENP GFP (45237, Addgene) at NheI / BamH1 ...
-
bioRxiv - Biochemistry 2021Quote: Site-directed mutagenesis was performed on KRAS 1-169 (Q61H, isoform b, a gift from Cheryl Arrowsmith, Addgene plasmid #25153) to obtain the wild-type sequence ...
-
bioRxiv - Biochemistry 2023Quote: E.coli codon optimized gBlocks encoding CAHS D and its mutant proteins used in this study were synthesized by (Integrated DNA Technologies) and cloned into pET-28 b (+) vector (Addgene) for bacterial expression ...
-
bioRxiv - Biochemistry 2024Quote: ... The pOPIN-B vector was used for recombinant PLpro expression and was a gift from Ray Owens (Addgene plasmid # 41142). All oligos used in this study were ordered from IDT ...
-
bioRxiv - Biochemistry 2024Quote: ... AriB or AriA-AriB were cloned into an arabi-nose-inducible UC Macrolab vector 8-B (Addgene #37502; ampicillin-resistant) and Ocr was cloned into an IPTG-inducible pTrc99A-based vector (kanamycin-resistant) ...
-
bioRxiv - Neuroscience 2020Quote: For retrograde tracing followed by STARmap (Fig. 6A, B) we injected 150 nL of AAVretro-Ef1a-FlpO (Salk vector core, Addgene #55637) or AAVretro-Ef1a-Cre (Salk vector core ...
-
bioRxiv - Biochemistry 2020Quote: Human ATAD2/B cDNA (UniProt codes Q9ULIO and Q6PL18) was a gift from Nicole Burgess-Brown (Addgene plasmid # 38916 and 39046)7 ...
-
bioRxiv - Genomics 2019Quote: ... shRNAs against KAP1 (shKAP1-B and shKAP1-D) were cloned into the pLKO.1.puro vector obtained from Addgene (http://www.addgene.org) using AgeI and EcoRI sites ...
-
bioRxiv - Cell Biology 2021Quote: ... the cytosolic domain of Miro1 (Miro1(ΔTM)) and the iLID binding peptide (SspB, obtained from Addgene #60415, gift from B. Kuhlman) were fused into pmCherry-C1 using EcoRI and KpnI ...
-
bioRxiv - Molecular Biology 2019Quote: ... ΔPPXY)-T2A-GFP were generated by PCR from pCDNA4/TO-HA-NLS-SV40-B-MYB (this work) and pSpCas9n(BB)-2A-GFP (PX461) (Addgene #48140). All entry vectors were subcloned into pENTR3C (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... WT and Lig4-/- abl pre-B cells and MCF10A human mammary epithelial cells used in this study all contain pCW-Cas9 (Addgene# 50661), which has a FLAG-tagged Cas9 cDNA under the control of a doxycycline-inducible promoter ...
-
bioRxiv - Immunology 2020Quote: ... Selected gRNAs shown in Figure 1 B and C were synthesized by IDT and cloned into eSpCas9(1.1) (a gift from Feng Zhang Addgene plasmid # 71814). The LC donor DNA of HuGL18 was designed as follows from 5′ to 3′ ...
-
bioRxiv - Immunology 2022Quote: ... were transduced at 0.3 MOI by both part A and B of the pooled Human GeCKO v2 CRISPR library (Addgene, Cat#1000000049), and subsequently selected using 2 µg/mL puromycin (Calbiochem ...
-
bioRxiv - Cancer Biology 2023Quote: A double cutting CRISPR/Cas9 approach with a pair of sgRNAs (sgRNA A and B) was used to completely excise exon 2 (322 bp region) of DYRK1A using a px458 vector (Addgene #48138) that was modified to express the full CMV promoter ...
-
bioRxiv - Developmental Biology 2021Quote: A mouse Cnr1 cDNA fragment (Addgene, #13391) was cloned into all-in-one tetracycline inducible plasmid (pAS4.1w.Ppuro-aON ...
-
bioRxiv - Cell Biology 2021Quote: ... and mCherry-Climp63(mouse) (Addgene plasmid #136293) were gifts from Gia Voeltz36 ...
-
bioRxiv - Neuroscience 2023Quote: ... and pCDNA3-mouse PKA-RIIalpha-mEGFP (Addgene plasmid # 45527 ...
-
bioRxiv - Genetics 2024Quote: To generate the B16F10 Capza3 KO lines the 2 CRISPR gRNAs enriched in the radiation alone and radiation and anti-PD1 antibody screen treatment conditions were cloned into the LRG vector (Addgene Plasmid # 65656). For WT controls a NTC gRNA from the CRISPR screen was cloned into the LRG vector ...
-
bioRxiv - Biophysics 2021Quote: ... consisting of the human brain isoform B of fyn (confirmed by BLAST alignment) was a gift from Filippo Giancotti (Addgene plasmid # 16032)(Mariotti et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... this cell line was co-transfected with a 9:1 ratio of pCENP-B-Cherry (a gift from Michael Lampson; Addgene plasmid #45219) and pPGKpuro resistance plasmid ...
-
bioRxiv - Microbiology 2023Quote: ... resistance flanked by the 5’ region of VDU and part of the VDU coding sequence was prepared by PCR using the plasmid pTREX-b-NLS-hSpCas9 (a gift from Rick Tarleton, Addgene plasmid #62543) as template and the donor TcVDU84BlastFOW and donor TcVDU84BlastREV ...
-
bioRxiv - Genetics 2023Quote: A phenotypically WT (ROSA+/cre CTIPc/c Bcl2+) v-abl immortalized B cell line was infected with lentivirus for doxycycline-inducible SpCas9 (Addgene Plasmid #50661). Single clones were generated and screened for high SpCas9 inducibility after doxycycline treatment (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... and 0.34 μg of viral entry protein (SARS-CoV-2 Spike, BEI #NR-53742) or pCMV-VSVG (a gift from B. Weinberg, Addgene plasmid #8454) using 8 μl of TransIT-293 (Mirus Bio #MIR 2705 ...
-
bioRxiv - Genetics 2023Quote: ... FlpOM was generated by introducing the human b-globin intron from CreM into a codon optimized Flp (Raymond and Soriano, 2007; Addgene plasmid # 13792), interrupting the coding sequence between amino acids 159 and 160 ...
-
bioRxiv - Cell Biology 2023Quote: ... two shRNAs targeting EZH2 (shEZH2-a: CCGGCCCAACATAGATGGACCAAATCTCGAGATTTGGTCCATCTATGTTGGGTTTTT G and shEZH2-b: CCGG CGGAAATCTTAAACCAAGAATCTCGAGATTCTTGGTTTAA GA TTTCCG TTTTTG) were designed and cloned into pLKO.1 vector (Addgene plasmid #10879) according to method by Moffat ...
-
bioRxiv - Cancer Biology 2024Quote: ... the Human GeCKOv2 CRISPR Knockout Pooled Library (A+B) in the lentiGuide-Puro vector backbone (gift from Feng Zhang; Addgene Plasmid # 1000000048) was amplified and purified as directed by Addgene ...
-
bioRxiv - Immunology 2022Quote: HEK293A cells stably expressing mouse NLRP3 (Addgene 75127), and ASC-GFP (Addgene 73957 ...
-
bioRxiv - Neuroscience 2021Quote: ... plus empty pEGFP and mouse neuroligin-1B (Addgene #15261 ...