Labshake search
Citations for Addgene :
101 - 150 of 337 citations for M CSF Mouse HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Rats intended for optogenetic experiments received AAV9 DO-hChR2-mCherry (0.4uL, titer ∼ 3.1 × 1013 GC/m, Addgene # 20297) injected unilaterally into the VP and retro-AAV Cre (titer ∼ 1.1 × 1013 GC/mL ...
-
bioRxiv - Cell Biology 2023Quote: ... were transfected with a complex of 4µg of pAAV2/8 (a gift from James M. Wilson, Addgene #112864), 4µg of pHelper (Takara Bio) ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV1-CamKII-GCaMP6f (pENN.AAV.CamKII.GCaMP6f.WPRE.SV40 was a gift from James M. Wilson – Addgene viral prep #100834-AAV1; http;//n2t.net/addgene:100834 ; RRID:Addgene_100834) was injected (∼50 nL at a depth of 1.25 mm below the surface of the dura ...
-
bioRxiv - Neuroscience 2024Quote: ... The plasmids pAdDeltaF6 (a gift from James M. Wilson, Addgene plasmid #112867; http://n2t.net/addgene:112867; RRID: Addgene_112867) and pAAV2/1 (a gift from James M ...
-
bioRxiv - Neuroscience 2024Quote: ... and pAAV2/1 (a gift from James M. Wilson, Addgene plasmid #112862; http://n2t.net/addgene:112862; RRID: Addgene_112862) were used for virus production ...
-
bioRxiv - Neuroscience 2019Quote: ... recombinant mouse E1 (Addgene plasmid # 32534), E2 (pGEX4T-1-UbcH5b) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Mouse Ddx5 WT(Addgene plasmid #88869) and Lys144 to Asn mutant(Addgene plasmid #88870 ...
-
bioRxiv - Neuroscience 2022Quote: ... and mouse IgG1 Fc (Addgene #28216) and IgG2a Fc (Addgene #114492) ...
-
bioRxiv - Neuroscience 2023Quote: ... pCDNA3-mouse PKA-RIalpha-mEGFP (Addgene plasmid # 45525 ...
-
bioRxiv - Neuroscience 2023Quote: ... pcDNA3-mouse PKA-RIbeta-mEGFP (Addgene plasmid # 45526 ...
-
bioRxiv - Neuroscience 2021Quote: ... Brg1L2/L2 mice were injected bilaterally either with a mix of 0.4 μL of pENN.AAV.hSyn.Cre.WPRE.hGH (AAV1, gift from James M Wilson, Addgene #105558, titration 1.1013 vg/mL) and 0.1 μL of pAAV.hSyn.GFP viruses (AAV1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... along with 0.8 µg of PiggyBac transposase plasmid (gift from M. Elowitz lab) and 1.2 µg of a non-targeting GFP plasmid (turboGFP; Addgene plasmid 69072 cloned into pcDNA backbone with CMV promoter) ...
-
bioRxiv - Biochemistry 2021Quote: ... Membrane (M) (was a gift from Jeremy Luban (Addgene plasmid #158074 and 158078; http://n2t.net/addgene:158078; RRID: Addgene_158078)) ...
-
bioRxiv - Molecular Biology 2022Quote: The lentiviral vectors pLVX-EF1alpha-IRES-Puro-2xStreg-SARS-CoV-2 (Nsp6, Nsp8, M) (Addgene plasmids #141395, #141372, #141374) were transfected into the HEK293T cells with packaging plasmids ...
-
bioRxiv - Cell Biology 2019Quote: The mCherry-DNKASH construct was made from the DNKASH-TSMod construct digested by AgeI/HpaI and mCherry from a PCR on a mCherry-cSrc construct (from M. Davidson, Florida State University, Tallahassee, FL; 55002; Addgene) (fwd ...
-
bioRxiv - Genetics 2021Quote: ... 16 ml of Opti-MEM was mixed with 72 μg of base editor encoding plasmid (ABE8e, Addgene #138489 or ABE8.20-m, Addgene #136300), 8 μg of pCS-GFP plasmid and 800μl Plus reagent ...
-
bioRxiv - Cancer Biology 2021Quote: ... MSCV EZH2 ΔSET-Hygro (cat# 49403) EZH2-Y641-F (cat# 80077) and pTRIPZ M)-YFP-EZH2 (cat# 82511) were procured from Addgene USA ...
-
bioRxiv - Cell Biology 2022Quote: ... RPE-1 TUB-mRFP cells were generated in our lab by transduction with lentiviral vectors containing tubulin m-RFP (Addgene). HEK293T cells at a 50-70% confluence were co-transfected with lentiviral packaging vectors (16.6 μg of Pax2 ...
-
bioRxiv - Neuroscience 2019Quote: ... Mice received unilateral stereotactic injections of an AAV2-hsyn-DIO-hM4D(Gi)-mCherry and an AAV9-CamKII-Cre (pENN.AAV.CamKII 0.4.Cre.SV40 was a gift from James M. Wilson (Addgene viral prep # 105558-AAV9)) into the CA1 and CA3 region of the right dorsal hippocampus ...
-
bioRxiv - Microbiology 2022Quote: ... pEGFP-N1-TFEB (38119) and pEGF-N1-Δ30TFEB (44445) were obtained from Addgene (a generous gift of Shawn M. Ferguson). pEGFP-2xFYVE (140047 ...
-
bioRxiv - Microbiology 2023Quote: HMGB1 plasmids for cell line construction were generated in a 2nd generation pLVX-M- puro transfer plasmid (Addgene plasmid# 125839). The HMGB1 sequence was obtained from the pcDNA3.1 Flag hHMGB1 plasmid (Addgene plasmid #31609).
-
bioRxiv - Genomics 2023Quote: ... We further replaced the Cas9 cassette with an nCas9/M-MLV-RT cassette from the pCMV-PE2 plasmid (Addgene, 132775). The lentiV2-pegRNA and lentiV2-ngRNA plasmids were constructed by replacing the Cas9 and Puromycin sequences in the lentiCRISPR v2 plasmid (Addgene ...
-
bioRxiv - Immunology 2023Quote: ... pDONR207 SARS-CoV-2 M and pDONR207 SARS-CoV-2 ORF3a (all plasmids were gifts from Fritz Roth via Addgene, # 141273 ...
-
bioRxiv - Developmental Biology 2021Quote: A mouse Cnr1 cDNA fragment (Addgene, #13391) was cloned into all-in-one tetracycline inducible plasmid (pAS4.1w.Ppuro-aON ...
-
bioRxiv - Cell Biology 2021Quote: ... and mCherry-Climp63(mouse) (Addgene plasmid #136293) were gifts from Gia Voeltz36 ...
-
bioRxiv - Neuroscience 2023Quote: ... and pCDNA3-mouse PKA-RIIalpha-mEGFP (Addgene plasmid # 45527 ...
-
bioRxiv - Biochemistry 2020Quote: ... anti-mouse IgG AlexaFluor-488 (Life Technologies A11029-EA. The following plasmids were used: mouse PM20D1-flag (Addgene 84566). pENN.AAV.tMCK.PI.eGFP.WPRE.bGH (Addgene 105556) ...
-
bioRxiv - Neuroscience 2021Quote: ... Plasmid for soluble PSD-95 PDZ domain 2 expression was obtained by first replacing eGFP into pEGFP-N1 by mIRFP via BamHI and BsrGI restriction sites (gift from M Davidson, Florida State University, and X Shu, UCSF, Addgene #54620) (Yu et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... smegmatis strains were generated with the ORBIT method (91). ORBIT requires transformation of the starting bacterial strain (M. smegmatis mc2155) with pKM444 (Addgene #108319), a plasmid that encodes a Che9c phage RecT annealase and a Bxb1 integrase ...
-
bioRxiv - Cell Biology 2022Quote: ... REEP1-mEmerald and REEP1-mCherry plasmids were generated by inserting a codon-optimized human REEP1 gblock into mEmerald-N1 (gift from M. Davidson; Addgene #53976) or mCherry-N1 backbones (Clontech) ...
-
bioRxiv - Cell Biology 2023Quote: ... SNAP-Rab7A and SNAP-Rab7A Q67L were made by cloning Rab7A sequence from EGFP-Rab7A and EGFP-Rab7A Q67L plasmids into pSNAP-tag (m) Vector (Addgene #101135). Soluble BFP (mTagBFP2 ...
-
bioRxiv - Cell Biology 2023Quote: ... The DNA fragment encoding SNAP-tag was amplified from the pSNAP-tag (m) vector (a gift from New England Biolabs & Ana Egana, Addgene #101135), and then inserted into the pDisplay vector (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... The pSAD 11.G H2B:GFP was obtained by taking advantage of the pSAD 11.G F3 expression vector (kindly provided by M. Tripodi, Cambridge University, AddGene #32634). The nucleotide sequence encoding the histone H2B-tagged GFP was designed and ordered via GeneArts (ThermoFisher Scientific) ...
-
bioRxiv - Immunology 2022Quote: HEK293A cells stably expressing mouse NLRP3 (Addgene 75127), and ASC-GFP (Addgene 73957 ...
-
bioRxiv - Neuroscience 2021Quote: ... plus empty pEGFP and mouse neuroligin-1B (Addgene #15261 ...
-
bioRxiv - Cell Biology 2021Quote: ... The generation of mouse myc-Bnip3 (Addgene #100796) was described previously 48 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse GeCKOv2 CRISPR knockout pooled library (Addgene #1000000053,18), pMD2.G and psPAX2 were transfected into Lenti-X 293T cells ...
-
bioRxiv - Biophysics 2020Quote: ... we overexpressed lamin A by transiently transfecting the intact cells with m-Cherry tagged plasmid DNA for lamin A which was a gift from Michael Davison (Addgene, plasmid # 55068). To surpass lamin A expression ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: We used a virus with the Gq-coupled designer receptor exclusively activated by a designer drug (DREADD) attached to the human synapsin promoter and the m-Cherry reporter (DR, AAV2 – hSyn – hM3Dq – mCherry; Addgene, Watertown, MA), as well as an empty vector control virus (Con ...
-
bioRxiv - Cell Biology 2020Quote: ... Human ASK3 cDNA was also subcloned into pcDNA3 with a C-terminal tdTomato-tag (cDNA was gifted by M. Davidson, Florida State University, via Addgene: plasmid #54653) or pcDNA4/TO with an N-terminal Venus- or EGFP-FLAG-tag ...
-
bioRxiv - Microbiology 2020Quote: ... carries the marker mutation A1244G and was cloned from the tdTomato-pBAD plasmid (a kind gift from Drs. M. Davidon, N. Shaner, and R. Tsien, Addgene plasmid #54856). The humanised reporter gene Renilla luciferase (GenBank AF362549 ...
-
bioRxiv - Genetics 2021Quote: ... or the catalytic domain (CD) of mouse Dnmt3a and the C-terminal part of mouse Dnmt3L (3a3L) (amplified from pET28-Dnmt3a3L-sc27 (Addgene #71827)) and cloned in PiggyBac plasmids under control of the TRE3G promoter ...
-
bioRxiv - Developmental Biology 2021Quote: The mouse Trim41 cDNA (ENSMUST00000047145) tagged with PA and 1D4 was inserted under the control of the mouse Clgn promoter (Addgene #173686) (Ikawa et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... two independent sgRNA against mouse Chk2 (GTATACATAGAGGATCACAG and GCTGGAGACAGTGTCTACCC) or mouse Trp53 (56) were cloned into pKLV-U6gRNA(BbsI)-PGKpuro2ABFP (Addgene, 50946). Lentiviral packaging plasmids (1µg pCMV-Rev ...
-
bioRxiv - Molecular Biology 2023Quote: Polymerase chain reaction (PCR) was used to isolate mouse AMPKγ1 cDNA from a mouse AMPKγ1-HA vector (#40605, Addgene, Watertown, MA, USA). Mouse AMPKγ1 cDNA was then cloned into the 3xFLAG-CMV10 vector (Sigma-Aldrich ...
-
bioRxiv - Genetics 2021Quote: ... 16 ml of Opti-MEM was mixed with 72 μg of base editor encoding plasmid (ABE8e, Addgene #138489 or ABE8.20-m, Addgene #136300), 8 μg of pCS-GFP plasmid and 800μl Plus reagent ...
-
bioRxiv - Cell Biology 2022Quote: ... and mCherry-Snx9 (#27678) (all mouse) were from Addgene.
-
bioRxiv - Neuroscience 2020Quote: ... Postsynaptic mouse neuroligin-1 was PCR amplified from Addgene #15260 ...
-
bioRxiv - Genetics 2024Quote: Mouse CRISPR Brie lentiviral pooled library (Addgene Plasmid # 170511) consisting of 79,637 gRNAs was co-transfected with packaging plasmids (psPAX2 and pMD2.G ...
-
bioRxiv - Biophysics 2023Quote: ... mouse Opa1 sequence was cloned into pR26-CMVconst (Addgene plasmid #127373 ...