Labshake search
Citations for Addgene :
101 - 150 of 895 citations for Gamma enolase ENO2 Human His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... A1AT/ SERPINA1 and PAI1/ SERPINE1 cDNAs were amplified from SERPINA-bio-His plasmid (Addgene #52182) and SERPINE1-bio-his (Addgene #52077 ...
-
bioRxiv - Molecular Biology 2020Quote: ... strains of interest were transformed with a plasmid containing His-tagged SUMO (Smt3-Hisx7) (Addgene) under the control of a copper inducible promoter ...
-
bioRxiv - Cell Biology 2021Quote: ... from the pcDNA3.1 Flag-His-ATM plasmid (kind gift of Michael Kastan; Addgene plasmid #31985) (67 ...
-
bioRxiv - Microbiology 2022Quote: ... 500 ml LB culture of pCDFDuet-1-6×His-SARS-CoV-2-NSP7/NSP8 (Addgene)-transformed E.coli BL21 DE3 strain was induced by isopropyl β-d-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmid pET28HIS-hAPE1 (for WT His-APE1 protein) was a gift from Primo Schaer (Addgene plasmid #70757 ...
-
bioRxiv - Pathology 2024Quote: ... BL21(DE3)-RIL Escherichia coli cells were transformed with pJ4M-TDP43-MBP-His (Addgene 104480) and grown on LB/Kanamycin/Chloramphenicol plates then used to inoculate 2L of TB/Kan/Cam/2g dextrose ...
-
bioRxiv - Neuroscience 2023Quote: ... and the injections of AAV5-hSyn-NES-his-CaMPARI2-WPRE-SV40 (2.5x10^12gc/ml Addgene 200nl measured using a Nano Injector ...
-
bioRxiv - Bioengineering 2024Quote: ... For CODE constructs that were built based on the pET-PE2-His backbone (Addgene, #170103), the culture was induced at 18°C for 5 hours followed by 26°C for 14-18 hours ...
-
MANF regulates unfolded protein response and neuronal survival through its ER-located receptor IRE1αbioRxiv - Cell Biology 2020Quote: ... pEZYflag and pEZYmyc-His were a gift from Yu-Zhu Zhang (Addgene plasmids #18700 and #18701). Gateway destination vectors for BiFC for N- and C-terminal tagging with Venus fluorescent protein fragments (pEZY BiFC N NV ...
-
bioRxiv - Biochemistry 2021Quote: ... The His-Sumo bacterial version was codon optimized and cloned into K27-Sumo (Addgene ID 169193) via NEBuilder HiFi DNA Assembly Cloning Kit (NEB) ...
-
bioRxiv - Cell Biology 2021Quote: ... His-Strep2-tag from 438-SNAP-V3 vector a gift from Scott Gradia (Addgene plasmid # 55223) with inserting CATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCAT sequence right in front of Strep II gene by PCR primer ...
-
bioRxiv - Biochemistry 2020Quote: MBP-hnRNPA2 LC, soluble His-tag purification as described (Ryan et al., 2018) (Addgene ID: 98661)
-
bioRxiv - Cell Biology 2019Quote: ... His-tagged SEPT5 plasmid was constructed by PCR amplifying SEPT5 from pCMV-Myc-tagged SEPT5 (Addgene plasmid # 27272 ...
-
bioRxiv - Synthetic Biology 2022Quote: A plasmid construct containing only the maturation protein and his-tagged coat protein dimer (Addgene # 179156) was transformed into Rosetta2™ (DE3 ...
-
bioRxiv - Cancer Biology 2023Quote: SULF2 ORF including C-terminal Myc-His tag was subcloned from its source vector (Addgene # 13003) to lentiviral transfer vector pHR-CMV-TetO2_3C-Twin-Strep (Addgene # 113883 ...
-
bioRxiv - Biochemistry 2022Quote: ... coli and subcloned in-line with his-tagged MBP construct (2CT-10 vector, Addgene plasmid #55209). Recombinant MBP-EndoH fusion was expressed in and purified from E ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral vector carrying human HNF4A was made by inserting human HNF4A825 (obtained from Addgene; cat# 31094) into the PGK-IRES-EGFP vector as described previously.26 Lentivirus was generated at the CCHMC viral vector core ...
-
bioRxiv - Developmental Biology 2021Quote: ... GST-human β-catenin (Addgene #24193), and NLS-mCherry (Addgene #49313 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pscALPSpuro-HsACE2 (human) (Addgene, MA, USA) were co-transfected with psPAX2 and pCMV-VSV-G packaging plasmids into HEK293T cells using FuGENE 6 (Promega ...
-
bioRxiv - Cancer Biology 2024Quote: ORF encoding human MARK2 (Addgene, 23404) was cloned into pFL system with an N-terminal Strep2SUMO tag ...
-
bioRxiv - Biochemistry 2024Quote: Recombinant human GST-CK2α’ (Addgene #27084) and recombinant human GST-CK2α (Addgene #27083 ...
-
bioRxiv - Neuroscience 2023Quote: ... human a-SYN (A53T mutant) (Addgene), and mt-Keima (Addgene) ...
-
Mediobasal hypothalamic FKBP51 acts as a molecular switch linking autophagy to whole-body metabolismbioRxiv - Neuroscience 2021Quote: ... A viral vector containing a Cre expressing cassette (pAAV-CMV-HI-eGFP-Cre-WPRE-SV40, Addgene; #105545) was used to induce Fkbp5 deletion in Fkbp5lox/lox mice ...
-
bioRxiv - Biophysics 2020Quote: ... Two plasmids containing full-length untagged Npl4 and C-terminal His-tagged Ufd1 were purchased from Addgene. Npl4 fragments were expressed in pET-28a vector with an N-terminal His-SUMO tag ...
-
bioRxiv - Biochemistry 2020Quote: hnRNPA2 LC (190-341), insoluble His-tag purification as described (Ryan et al., 2018) (Addgene ID: 98657)
-
bioRxiv - Biochemistry 2022Quote: AR-LBD (663-919) containing an N-terminal His-tag and encoded in pET15b plasmid (Addgene #89083) was expressed in Rosetta (DE3 ...
-
bioRxiv - Neuroscience 2024Quote: ... 6 × 107 RPE1 cells were infected with the human sgRNA library (Human GeCKO v2 Library Cat#1000000048, Addgene) at an MOI of ∼0.3 ...
-
bioRxiv - Immunology 2021Quote: ... gene sequence was subcloned from pcDNA5/FRT/TO HIS HSPA1A (a gift from Harm Kampinga, Addgene plasmid # 19537; http://n2t.net/addgene:19537; RRID:Addgene_19537)(46 ...
-
bioRxiv - Biochemistry 2019Quote: ... pMAL-his-LbCpf1-EC was a gift from Jin-Soo Kim (Addgene plasmid # 79008; http://n2t.net/addgene:79008; RRID:Addgene_79008) (D ...
-
bioRxiv - Neuroscience 2020Quote: ... pEZYmyc-His (Addgene plasmid #18701; http://n2t.net/addgene:18702; RRID: Addgene_18701; a gift from Yu-Zhu Zhang [72]), that was digested with the same enzymes ...
-
bioRxiv - Biochemistry 2022Quote: Codon optimized plasmids encoding the individual His-tagged PBRM1 bromodomain constructs were received from Nicola Burgess-Brown (Addgene plasmid numbers 38999 ...
-
bioRxiv - Biophysics 2022Quote: ... GST-mCherry-FYVE (https://www.protocols.io/view/expression-and-purification-protocol-of-gst-mch-fy-b8k5ruy6) and His-TEV-ATG3 (Addgene_169079 ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmid pET28HIS-hAPE1 (for WT His-APE1 protein) was a gift from Primo Schaer (Addgene plasmid #70757; http://n2t.net/addgene:70757; RRID:Addgene_70757) (69) ...
-
bioRxiv - Biochemistry 2023Quote: The construct for E.coli expression of WT caspase-3 (pET23b-Casp3-His) was obtained from Addgene (plasmid 11821). The construct for mammalian expression of caspase-3/GFP was a gift from Dr ...
-
bioRxiv - Biochemistry 2024Quote: ... The construct for LbCas12a expression (pMAL-His-LbCpf1-EC) - a gift from Jin-Soo Kim (RRID: Addgene 79008) (Kim et al. ...
-
bioRxiv - Biophysics 2024Quote: His-tagged TEV protease (pDZ2087, a gift from David Waugh (Addgene plasmid # 92414 ; http://n2t.net/addgene:92414 ; RRID:Addgene_92414)) was expressed in BL21(DE3)CodonPlus E ...
-
bioRxiv - Systems Biology 2021Quote: ... human knockout CRISPR v1 library (Addgene #67989) (39) ...
-
bioRxiv - Microbiology 2021Quote: The human CRISPR Brunello library (Addgene 73178) (16 ...
-
bioRxiv - Neuroscience 2022Quote: ... including the human IgG1 Fc (Addgene #145165), and mouse IgG1 Fc (Addgene #28216 ...
-
bioRxiv - Microbiology 2024Quote: ... The human RAB6Q72L was subcloned from Addgene plasmid #49483 into a bacteria expression pGEX-4T-1 vector encoding a N-terminal GST tag followed by a TEV cleavage site.
-
bioRxiv - Biochemistry 2024Quote: ... and recombinant human GST-CK2α (Addgene #27083) enzymes were produced in-house as previously described [30] ...
-
bioRxiv - Cell Biology 2023Quote: ... from human pcDNA3.1-2xFLAG-SREBP1a (#26801, Addgene), pcDNA3.1-2xFLAG-SREBP1c (#26802 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human Sin1.1 was PCR-amplified from Addgene 73388 plasmid (gift from Taekjip Ha32 ...
-
bioRxiv - Evolutionary Biology 2024Quote: Coding sequences for human RIPK1 (Addgene #78834), human RIPK2 (ORFeome ID #4886) ...
-
bioRxiv - Microbiology 2021Quote: ... pRSET his-eGFP [76] was used as a backbone and was a gift from Jeanne Stachowiak (Addgene plasmid # 113551). Wild-type IDR was PCR amplified from a full-length PEMV2 infectious clone ...
-
bioRxiv - Neuroscience 2021Quote: ... and retrograde AAV encoding Cre recombinase (AAVretro-hSyn-HI-eGFP-Cre (titer 1.17 x 1013 GC/ml, Addgene 105540) were stereotaxically injected into S2 or M1 and nwS1 ...
-
bioRxiv - Bioengineering 2020Quote: Plasmid pBAD-His-6-Sumo-TEV-LIC cloning vector (8S) was a gift from Scott Gradia (Addgene plasmid 37507). The plasmid was modified via restriction enzyme digestion (final construct ...
-
bioRxiv - Cell Biology 2020Quote: ... Histidine-tagged ubiquitin (pCI-His-hUbi, #31815) and Ha-tagged p62 (HA-p62, #28027) plasmids were purchased from Addgene. DNA constructs corresponding to the mature form of human UBTD1 were subcloned from pEGFP-N1 (Novagen ...
-
bioRxiv - Biochemistry 2022Quote: ... with an initial Met and a cleavable C- terminal TEV 6x-His tag was a gift from Ginkgo Bioworks (Addgene plasmid 145611; http://n2t.net/ addgene:145611; RRID: Addgene_145611). pGBWm4046852 (coding for full- length nsp8 ...
-
bioRxiv - Biochemistry 2022Quote: ... with an initial Met and a cleavable C-terminal TEV 6x-His tag) was a gift from Ginkgo Bioworks (Addgene plasmid 145584; http://n2t.net/ addgene:145584; RRID: Addgene_145584). The pET-28a-nsp9 gene was obtained from BEI Resources (NR-53501) ...