Labshake search
Citations for Addgene :
101 - 150 of 467 citations for Cow Neuronal Acetylcholine Receptor Subunit Alpha 7 CHRNA7 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... 7 μg Cas9 nuclease plasmid (pX459, Addgene #62988) 1.4 μg pPN298 and 1.4 μg pPN306 were electroporated into 2.5×106 cells at 1050V ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.1 μL of adeno-associated virus serotype 9 (AAV9) carrying GCaMP6f under the excitatory neuronal promoter CaMKII (AAV-CaMKII-GCaMP6f) (Addgene) to co-transfect the TRPV1 and GCaMP6f into neurons.
-
bioRxiv - Neuroscience 2020Quote: All constructs containing the N/Q-rich region of the neuronal-specific Aplysia CPEB (residues 1-160) were cloned by PCR using a full-length clone (Addgene) as the template ...
-
bioRxiv - Neuroscience 2023Quote: Cortical expression of the calcium sensor GCaMP7c was attained via focal viral injection of AAV1 under the human synapsin (hsyn) promoter for broad neuronal expression (#105321, Addgene).41 CD-1 male mice (P42-56 ...
-
Intra-mitochondrial proteostasis is directly coupled to alpha-synuclein and Amyloid β 1-42 pathologybioRxiv - Neuroscience 2020Quote: ... Alpha-synuclein-EYFP was then cloned into the pLJM1 backbone for lentiviral expression (Addgene: 19319) (68) ...
-
bioRxiv - Physiology 2021Quote: ... The alpha myosin heavy chain/puro rex/neo was a gift from Mark Mercola (Addgene plasmid #21230 ...
-
bioRxiv - Developmental Biology 2022Quote: αBTX mRNA was synthesized from the Pmtb-t7-alpha-bungarotoxin vector (Megason lab, Addgene, 69542) as described in Swinburne et al ...
-
bioRxiv - Cell Biology 2023Quote: ... which was a gift from Alpha Yap (Addgene plasmid # 71366; http://n2t.net/addgene:71366; RRID:Addgene_71366) (Han et al. ...
-
bioRxiv - Microbiology 2023Quote: ... The pET21a-alpha-synuclein was obtained from Michael J Fox Foundation MJFF (Addgene plasmid # 51486) as a kind gift ...
-
bioRxiv - Cell Biology 2022Quote: ... The Capping Protein (F-actin-capping protein subunit alpha-1 and F-actin-capping protein subunit beta) plasmid was a gift from Antoine Jégou & Guillaume Romet-Lemonne (Addgene plasmid #89950).
-
bioRxiv - Bioengineering 2020Quote: The following sequence for the I-Adα.TCRα chimeric CRMpMHCIIα subunit was subcloned into the pMSCV-ires-CFP II (gift from Dario Vignali, Addgene plasmid # 52109) via 5’EcoRI and 3’XhoI: gaattccgccaccatgccgtgcagcagagctctgattctgggggtcctcgccctgaacaccatgctcagcctctgcggaggtgaagacgacattgaggccgaccacgtaggcttctatggtacaactgtttatcagtctcctggagacattggccagtacacacatgaatttgatggtgatgagttgttctatgtggacttggataagaagaaaactgtctggaggcttcctgagtttggccaattgatactctttgagccccaaggtggactgcaaaacatagctgcagaaaaacacaacttgggaatcttgactaagaggtcaaatttcaccccagctaccaatgaggctcctcaagcgactgtgttccccaagtcccctgtgctgctgggtcagcccaacacccttatctgctttgtggacaacatcttcccacctgtgatcaacatcacatggctcagaaatagcaagtcagtcacagacggcgtttatgagaccagcttcctcgtcaaccgtgaccattccttccacaagctgtcttatctcaccttcatcccttctgatgatgacatttatgactgcaaggtggagcactggggcctggaggagccggttctgaaacactgggaacctgagattccagcccccatgtcagagctgacagaaactgtgtgtgatgccacgttgaccgagaaaagctttgaaacagatatgaacctaaactttcaaaacctgtcagttatgggactccgaatcctcctgctgaaagtagcgggatttaacctgctcatgacgctgaggctgtggtccagttgactcgag
-
bioRxiv - Molecular Biology 2023Quote: ... An AAV that only expressed the mCherry protein under the same neuronal promoter was use as control condition (Addgene Plasmid #114472). Wildtype and Cdr1as-KO neurons were infected at DIV4-6 by directly adding the viral particles into the culturing media at a titer of 109 VG/ml ...
-
bioRxiv - Biophysics 2019Quote: ... mTagRFP-T-Mito-7 (mTagRFP-mito, Addgene plasmid # 58023) were gifts from Michael Davidson ...
-
bioRxiv - Neuroscience 2020Quote: ... titer value ≥ 7×1012 vg/ml (Addgene, #59462-AAVrg).
-
bioRxiv - Neuroscience 2020Quote: ... rAAV5-hSyn-eYFP (Titer ≥ 7×1012 vg.mL−1, Addgene), rAAV5-hSyn-hChR2(H134R)-mCherry (Titer ≥ 7×1012 vg.mL−1 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and pACUH-GFP11×7-mCherry-α-tubulin (Addgene: 70218)39.
-
Astroglia proliferate upon biogenesis of tunneling nanotubes and clearance of α-synuclein toxicitiesbioRxiv - Cell Biology 2023Quote: ... plasmid and another population with mEGFP-lifeact-7 (Addgene #58470 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV5-hSyn-mCherry (≥ 7 x 1012vg/mL, Addgene # 114472) or AAVrg-hSyn-Cre (≥ 1.8 x 1013 vg/ml ...
-
bioRxiv - Cancer Biology 2021Quote: The PPARGC1A (PGC1α) gene was amplified from the vector pcDNA myc PGC-1 alpha (Addgene, 10974) using primers containing BamHI and EcoRI cloning sites (PPARGC1A_BamHI_F ...
-
bioRxiv - Immunology 2019Quote: ... Lentiviral vector pBABE-puro-SDF-1 alpha was a gift from Bob Weinberg (Addgene plasmid #12270) 75 ...
-
bioRxiv - Microbiology 2020Quote: ... where the gpdA promoter and the trpC terminator together with the HDV self-cleaving sequence were amplified from vector pFC334 (AddGene ID # 87846)33 and LacZ alpha gene was amplified from the MoClo ToolKit vector pICH41308 (AddGene ID # 47998)55 ...
-
bioRxiv - Microbiology 2019Quote: ... ADRB1 was amplified from pcDNA3 Flag beta-1-adrenergic-receptor (gift from Robert Lefkowitz; Addgene plasmid # 14698). All fragments contained ~20bp overhangs and were assembled into EcoRV cut pLenti CMV Puro DEST (w118-1 ...
-
bioRxiv - Biochemistry 2021Quote: ... and pT7-EGFP-C1-HsDCP2 were gifts from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Cell Biology 2023Quote: ... pT7-EGFP-C1-HsDCP1a was a gift from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Cell Biology 2022Quote: ... mCh-alpha-tubulin63 was a gift from Gia Voeltz (Addgene plasmid # 49149; http://n2t.net/addgene:49149; RRID:Addgene_49149). EGFP-DCX64 was a gift from Joseph Gleeson (Addgene plasmid # 32852 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The constitutively active PKC mutant expression plasmid (PKC alpha CAT) was a gift from Bernard Weinstein (Addgene plasmid # 21234 ...
-
bioRxiv - Molecular Biology 2023Quote: ... was generated by Gibson assembly of the following fragments: the EF-1 alpha promoter (from Addgene #2261), the Kozak-3XFLAG fragment (from c3GIC9 ...
-
bioRxiv - Biophysics 2023Quote: The EGFP-alpha-synuclein gene was amplified from Addgene plasmid # 40822 (EGFP-alpha-synuclein-WT was a gift from David Rubinsztein (http://n2t.net/addgene:40822; RRID:Addgene_40822). The forward (5’-GCCCATGGTGAGCAAGGGCGAGGAG-3’ ...
-
bioRxiv - Biophysics 2020Quote: ... and EBFP2-Nucleus-7 (nuclear localization signal, Addgene, plasmid #55249), using GenJet transfection reagent (Signagen) ...
-
bioRxiv - Cell Biology 2020Quote: mEGFP-Lifeact-7 (gift of Michael Davidson; Addgene plasmid # 54610) was transferred into pCDH-CMV-MCS-EF1-Puro (System Biosciences ...
-
bioRxiv - Cell Biology 2022Quote: ... mCardinal-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54663 ...
-
bioRxiv - Cell Biology 2019Quote: mEGFP-Lifeact-7 (gift of Michael Davidson; Addgene plasmid # 54610) was transferred into pCDH-CMV-MCS-EF1-Puro (System Biosciences ...
-
bioRxiv - Neuroscience 2020Quote: ... rAAV5-hSyn-DIO-mCherry (Titer ≥ 7×1012 vg.mL−1, Addgene), AAVrg-pCAG-FLEX-tdTomato-WPRE (Titer ≥ 1×1013 vg.mL−1 ...
-
bioRxiv - Neuroscience 2020Quote: ... together with 2.8 μg of mWasabi-Mito-7 (Addgene #56508) (35 ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV2-retro-CAG-GFP (Addgene, 7×10^12 gc/ml), AAV2-retro-AAV-CAG-tdTomato (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV5:GFAP-Cre (titer:≥7×10¹² GC/ml, Addgene) viruses were injected with a 10μl Neuros syringe (Hamilton ...
-
bioRxiv - Bioengineering 2022Quote: COS-7 cells were transfected with mEmerald-Sec61b-C1 (Addgene #90992 ...
-
bioRxiv - Cancer Biology 2022Quote: ... mEmerald-Rab11a-7 was a gift from Michael Davidson (Addgene plasmid #54245 ...
-
bioRxiv - Neuroscience 2020Quote: ... sRed2-Mito-7 and pEGFP-LC3 were obtained from Addgene. DsRed-KDEL was created by inserting an ER retention signal sequence (AAGGACGAGCTG ...
-
bioRxiv - Cell Biology 2021Quote: ... mCherry-Rab5a-7 was a gift from Michael Davidson (Addgene plasmid # 55126 ...
-
bioRxiv - Cell Biology 2021Quote: ... pmCherry-Lifeact-7 (Addgene #54491, gift from Dr. Michael Davidson) and pcDNA3.1-L1CAM (Addgene # 12307 ...
-
bioRxiv - Cell Biology 2022Quote: ... mCherry-Rab7a-7 was a gift from Michael Davidson (Addgene plasmid #55127 ...
-
bioRxiv - Neuroscience 2022Quote: mRuby-Mito-7 was a gift from Michael Davidson (Addgene plasmid #55874 ...
-
bioRxiv - Cell Biology 2023Quote: ... mTagBFP-Nucleus-7 was a gift from Michael Davidson (Addgene plasmid # 55265 ...
-
bioRxiv - Developmental Biology 2022Quote: The following plasmids were used: mCherry-EB3-7 (Addgene 55037), Ect2-GFP (Dehapiot et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... GFP-2xML1N (#67797) or mNeonGreen-EB3-7 were from Addgene or Allele Biotech ...
-
bioRxiv - Biophysics 2023Quote: ... EGFP-Vimentin-7 was a gift from Michael Davidson (Addgene plasmid #56439 ...
-
bioRxiv - Cell Biology 2024Quote: ... and 7 µg pMD2.G (gift from Didier Trono, Addgene plasmid #12259 ...
-
bioRxiv - Cell Biology 2024Quote: ... mEmerald-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54148 ...
-
bioRxiv - Cell Biology 2020Quote: ... Beta-2-adrenergic receptor-CFP was a gift from Catherine Berlot (Addgene plasmid # 55794; http://n2t.net/addgene:55794; RRID:Addgene_55794) 39 ...