Labshake search
Citations for Addgene :
101 - 150 of 161 citations for CdSeTe ZnS Quantum Dots NIR region Water solvent 760nm since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... RNA of the amplified dCas9-KRAB region from the Lenti-(BB)-EF1a-KRAB-dCas9-P2A-EGFP plasmid (a gift from Jorge Ferrer; Addgene plasmid #118156 ...
-
bioRxiv - Genomics 2020Quote: ... a total of 4 guides flanking the region to be deleted (2 on each side) were cloned into the pX459-v2 vector (Addgene #62988) (Ran et al. ...
-
bioRxiv - Biochemistry 2020Quote: An sgRNA sequence (5’-GCCCAATTCAGAGAGACATG-3’) targeting the genomic region immediately downstream the CDK12 start codon was cloned into the PX458 vector (Addgene 48138). The 3xFLAG knock-in repair template was constructed in a pTOPO-TA vector (Mei5bio ...
-
bioRxiv - Bioengineering 2021Quote: ... nanobody sequences were PCR amplified with primers containing terminal regions of homology for cloning into a pRset plasmid (Addgene plasmid 3991)(Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... which contained: flanking sequences of the YKL075C gene and the KanMX6 coding region from the plasmid pFA6-KanMX6 (Addgene, Watertown MA). All transformations were carried out using the lithium acetate and transformants were identified as colonies that grow on selective solid media ...
-
bioRxiv - Developmental Biology 2022Quote: ... Plasmids containing coding regions for the fast-folding fluorescent proteins sCFP3A and Venus/YFP (Balleza et al., 2018) were obtained from Addgene (www.addgene.org). Partial or complete coding regions for Can-elt-3 ...
-
bioRxiv - Neuroscience 2021Quote: ... which was generated by replacing a cassette of a ccdB gene and attR1 and attR2 sites with the coding region of AAV-EF1α-DIO-PSD95.FingR-EGFP-CCR5TC (Addgene #126216)18.
-
bioRxiv - Cell Biology 2022Quote: ... homology recombination cassettes containing the desired knock-in DNA with flanking regions of homology of 1075 bp to the target locus were co-transfected with a version of pSpCAS9(BB) (Addgene, 48139) containing the guide RNA sequence 5’-TCTTTGATGCTAGTTAAAGT-3’ and modified to removed puromycin resistance ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Synthetic and control promoter parts were assembled with the omega 5’ untranslated region from tobacco mosaic virus (5UTR-ΩTMV; pICH41402, Addgene #50285), the coding sequence of firefly luciferase (LucF ...
-
bioRxiv - Immunology 2021Quote: ... the Cas9 endonuclease and a single guide RNA (sgRNA) targeting the region in which the base pair change was expected to take place (Addgene 62988). The single stranded donor oligonucleotide (ssODN ...
-
bioRxiv - Biochemistry 2020Quote: ... the coding region of the SunTag and Kif18b was obtained by PCR of a pCMV-SunTag-Kif18b-PP7 template (Addgene #128606), using the following primers ...
-
bioRxiv - Genomics 2021Quote: ... a primer binding site and restriction sites for SgsI and SdaI into the Bsp1704I site at the 3’ end of the GFP coding region of pcDNA3-EGFP (Addgene #13013). The modified plasmid was cut with SgsI and SdaI (Fermentas FastDigest ...
-
bioRxiv - Biochemistry 2021Quote: ... 30 base regions of the dnaB gene (S1 Table) targeting the mutation site were inserted into the pCRISPR plasmid (Addgene: 42875) as a guide RNA (gRNA ...
-
bioRxiv - Cell Biology 2021Quote: ... Different sgRNA sequences targeting promoter region of Smpdl3b (Table S4) were cloned into plasmid pSLQ1651-sgRNA(F+E)-sgGal4 (Addgene #100549) and then were packed into lentivirus ...
-
bioRxiv - Cell Biology 2023Quote: ... Mapt exon 4 and flanking the intron regions were PCR amplified using Phusion High-Fidelity DNA polymerase and inserted into NheI/BamHI digested pFlareA Plasmid (Addgene, 90249) and sequenced ...
-
bioRxiv - Plant Biology 2023Quote: ... Guide RNA targeting a unique region of OsCLSY3 gene at 1st exon (UCCUCUCGGCCCUCCAACAG) was cloned into pRGEB32 vector (Addgene Plasmid #63142) (Xie and Yang ...
-
bioRxiv - Developmental Biology 2024Quote: ... sgRNA oligos targeting the C-terminal region of target genes were cloned into the pX330 Cas9/sgRNA expression plasmid (Addgene 42230). For generation of the reporter line ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2018] genomic DNA using RLO336/RLO338 and RLO337/RLO339 primers (Table 2) which introduce sequences homologous to the regions flanking the SacI and HindIII sites of pRG216 (Addgene #64528) [Gnügge and Rudolf 2017] ...
-
bioRxiv - Developmental Biology 2023Quote: A sgRNA targeting the arginine finger region of SYNGAP1 was cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid #62988). This ...
-
bioRxiv - Neuroscience 2023Quote: ... An additional round of CRISPR/Cas9 genome editing was performed on one clonal cell line to further disrupt the coding region of endogenous Scn9a using recombinant pX458 plasmid (pSpCas9-2A-GFP; Addgene #48138) and a gRNA targeting the in-frame deletion (Scn9a ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... guides targeting the sequence in the same intergenic region utilized by the ttTi5650 MosSCI site have previously been described (Dickinson et al., 2015) and inserted into pDD162 (Addgene #47549) to make plasmid pMS4 ...
-
bioRxiv - Neuroscience 2023Quote: ... the coding sequence of the extracellular region of human TfR1 (residues 89–760) were amplified by PCR and inserted into pCMV6-XL4 FLAG-NGRN-Fc (Addgene #115773) with EcoRV and XbaI sites ...
-
bioRxiv - Molecular Biology 2022Quote: Lentiviral plasmids expressing rABE or APOBEC1 were generated by inserting the deaminase region into pSLIK-TT-RBFOX2 plasmid backbone (Addgene #59770) with Gibson cloning ...
-
bioRxiv - Plant Biology 2022Quote: The Tet-Off system was engineered by fusing the promoter and coding region of MoVps35 to pFGL1252_TetGFP(Hyg) vector (Addgene ID 118992), which contains a specific Tet-off cassette activated by tetracycline or doxycycline ...
-
bioRxiv - Cancer Biology 2024Quote: A double cutting CRISPR/Cas9 approach with a pair of sgRNAs (sgRNA A and B) was used to completely excise exon 2 (322 bp region) of DYRK1A using a px458 vector (Addgene #48138) that was modified to express the full CMV promoter ...
-
bioRxiv - Neuroscience 2024Quote: ... and the 3’ homology arm (1020 base pair downstream of the Cas9 cleavage site in the Shv gene region) was cloned into pHD-DsRed (Addgene, # 51434). Both cloned vectors were injected into fly stocks containing Cas9 (BDSC 55821 ...
-
bioRxiv - Neuroscience 2024Quote: LexAop-Shv RNAi and LexAop-Shv fly lines were generated by subcloning Shv-RNAi hairpin sequence based on VDRC Shv-RNAi design or the coding regions of Shv which contains a V5 tag into the pJFRC19-13XLexAop2-IVS-myr::GFP vector (Addgene, 26224). Both lines were inserted into the X chromosome specific position by microinjecting the plasmid into a P{CaryP}attP18 fly line (BDSC ...
-
bioRxiv - Cell Biology 2024Quote: sgRNA sequences targeting Atg7 (CACCGTCTCCTACTCCAATCCCGTG), Pcyt2, (CACCGCCATGATCCGGAACGGGCA) or a non-genic region on mouse chromosome 8 (Chr8, ACATTTCTTTCCCCACTGG) were cloned into lentiCRISPRv2 (Addgene, 52961). sgRNA sequences targeting Trp53 (GAAGTCACAGCACATGACGG ...
-
bioRxiv - Biochemistry 2024Quote: Mutations of phosphorylation sites within the SR region were generated via site-directed mutagenesis based on either the tag-free SARS-CoV-2 Nucleocapsid protein plasmid (Addgene, #177937) or the Strep-tagged SARS-CoV-2 Nucleocapsid protein plasmid (Dr ...
-
bioRxiv - Cancer Biology 2024Quote: ... in which the TURBO-ID region was substituted by a 3HA-tag and the murine form of Sox11 (obtained from Addgene: #120387) was cloned after the tag (between restriction sites for EcoRI and BamHI) ...
-
bioRxiv - Synthetic Biology 2024Quote: The sgRNA oligonucleotides targeting human RAI1 promoter regions were designed using the Benchling gRNA Design Tool.39 The sadCas9-2 × VP64 vector (Addgene #135338)40 was used as a backbone vector ...
-
bioRxiv - Microbiology 2021Quote: ... a 20 nucleotide guide RNA (gRNA) sequence targeting the IRF7 protein-coding region was inserted into the lentiCRISPRv2 vector (Addgene; catalog #52961). The IRF7 guide sequences used was ...
-
bioRxiv - Developmental Biology 2020Quote: ... DBD and AD sequences along with the Drosophila synthetic minimal core promoter (DSCP) region were amplified using PCR from vectors pBPZpGal4DBDUw and pBPp65ADZpUw (Addgene clone 26234) using primers that added NotI and AvrII restriction sites (CTGATCGCGGCCGCAAAGTGGTGATAAACGGCCGGC and GATCAGCCTAGGGTGGATCTAAACGAGTTTTTAAGCAAACTCAC) ...
-
bioRxiv - Developmental Biology 2020Quote: ... targeting the 5’ (5’-AGTGCGCTTCGTCACTGCAC-3’) and 3’ (5’-TCCTCCCGCCCCGACGCGGA-3’) region of the Spen ORF were cloned in the Cas9-GFP pX458 vector (Addgene plasmid #48138). Compatible 5’ and 3’ Homology arms (HA ...
-
bioRxiv - Cell Biology 2022Quote: Guide RNA designed to cut close to the 70-nucleotide region upstream of the ADC17 start codon (agtaacataatgtgctcagcagg) was inserted into pML104 (Addgene number: 67638) to generate pML104-ADC17-70nt ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 + 3 gRNAs targeting either side of the +3 kb enhancer core region (targeting sequences listed in Supplementary Table 2) were cloned into pX330 vector (Addgene plasmid #42230). mESCs were co-transfected with a mixture of all 6 CRISPR plasmids and a plasmid containing a blasticidin expression cassette for selection ...
-
bioRxiv - Biophysics 2020Quote: The plasmid containing 1.6 kb telomeric TTAGGG repeats with a 23-bp interruption linking two (TTAGGG) 135 regions (T270, 5.4 kb) was purchased from Addgene (plasmid pSXneo(T2AG3), #12403 ...
-
bioRxiv - Cell Biology 2022Quote: ... expressing myristoylated FGFR1 cytoplasmic region fused with the PHR domain of cryptochrome2 and mCitrine (gift from Won Do Heo (Addgene plasmid # 59776), (Kim et al. ...
-
bioRxiv - Developmental Biology 2022Quote: The pTT3-eGFP vector was constructed by replacing the C-terminal tag encoding region of a bait protein vector (52) (Addgene ID 36150) with eGFP ...
-
bioRxiv - Neuroscience 2021Quote: ... Adjacent 2kb 5’ and 3’ homology regions were cloned into pHD-DsRed-attP (gift from Melissa Harrison & Kate O’Connor-Giles & Jill Wildonger, Addgene plasmid # 51019, RRID:Addgene_51019) 5’ region via EcoRI/NotI ...
-
bioRxiv - Biophysics 2020Quote: ... targeting the coding region of ASIC1 was cloned into Bbsl-linearized pSpCas9(BB)-2A-GFP vector (a kind gift from Feng Zhang, Addgene plasmid #48138) as previously described25 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pAAV-EF1a-FLuc plasmid was generated by replacing the TdRed sequence in pAAV-EF1a-TdRed (unpublished, see below) with the FLuc gene with the regulatory WPRE region from pAAV-CAG-FLuc (Addgene Cat# 83281). Restriction enzymes BamHI-HF and SalI-HF were used to release the 3.4 kb vector band from pAAV-EF1a-TdRed as well as the 2.3kb FLuc-WPRE sequence from pAAV-CAG-FLuc ...
-
bioRxiv - Bioengineering 2022Quote: ... we generated 2 sgRNA plasmids each harboring 2 distinct sgRNAs targeting the promoter regions of eve (AAEL007369, OA-1053A, Addgene plasmid #184006) and hh (AAEL006708 ...
-
bioRxiv - Cell Biology 2022Quote: ... was created by cloning the mitochondria-localized mCherry-GFP1-10 region from plasmid MTS-mCherry-GFP1-10-Hyg-N15 (Addgene Plasmid #91957) into a lentiviral backbone with an EF-1α promoter driving the expression ...
-
bioRxiv - Cell Biology 2023Quote: Two small gRNA (#1-GGGGTATTTCAATCAGAAGC; #2-ACGGGAAGCGCACAGTTTAT) targeting msps genomic region were synthesized and inserted into the pCFD5 vector (74) (Addgene, Plasmid #73914) via BbsI digestion ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... were cloned into pCFD4 (Addgene plasmid 49411)57 and the 1kb regions upstream and downstream of the cut sites were cloned into vector pHD-attP-DsRed (Addgene plasmid 51019)58 ...
-
bioRxiv - Developmental Biology 2023Quote: ... sgRNAs 5’-CCCCATGGACATACCCACTG-3’ and 5’-CCAGTCGAGCAGAAAAGTGT-3’ defining a 244 bp region in Nodal exon 2 were cloned into pX458 (Addgene plasmid #48138) or pX459 (Addgene plasmid #48139 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The sgRNA oligos targeting the different genomic regions of HOTAIR gene were synthesized and cloned into the BbsI site of PX548 (Addgene, Cat. No: 48138) construct following manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... Plasmids used for mammalian one-hybrid experiments included segments of the β-catenin coding region cloned into pCMV-GAL4 vector (gifted by Liqun Luo (Addgene plasmid # 24345)) to create pGAL4-βCAT plasmids ...
-
bioRxiv - Cell Biology 2022Quote: ... containing the sgRNA sequence targeting the coding region of the sec11a and sec11c genes were inserted into the pSpCas9(BB)-2A-Puro (PX459) vector (#48139; Addgene, Watertown, MA, USA) (digested with BbsI ...