Labshake search
Citations for Addgene :
101 - 150 of 797 citations for Adenovirus Type 5 Particles Wild type since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: Human cDNAs of wild-type TAZ and mutants containing deletions of the WW or CC domains (gifts from Dr. Jeff Wrana: Addgene #24809, #24811, and #24816) were cloned into a pcDNA3-FLAG vector by PCR ...
-
bioRxiv - Neuroscience 2023Quote: ... muscarinic receptor type 3/1 (CHRM3/1, Addgene) and GFP were co-expressed at a ratio of 8:4:3:1 ...
-
bioRxiv - Bioengineering 2023Quote: ... Coli Type I Cascade system (Addgene #106270-106275) and Pae Type I Cascade System (Addgene #153942 and 153943) ...
-
bioRxiv - Cancer Biology 2023Quote: Retroviral vectors expressing the cDNA of wild-type c-Myc and GFP in the murine stem cell virus backbone were purchased from Addgene (MSCV-Myc-IRES-GFP, Plasmid #18770). Doxycycline-inducible constructs were obtained by cloning c-Myc cDNA into GC385-S backbone ...
-
bioRxiv - Neuroscience 2021Quote: ... adenovirus helper plasmid pAdDeltaF6 (Addgene 112867) and pAAV-hSyn-EGFP (Addgene 50465) ...
-
bioRxiv - Microbiology 2023Quote: ... and pBTK401 (Type 8) (Addgene_65109, Addgene_183127, Addgene_65179, Addgene_183126, Addgene_110593, Addgene_110597), and dsRNA target sequence (Type 3 ...
-
bioRxiv - Microbiology 2023Quote: ... and pBTK401 (Type 8) (Addgene_65109, Addgene_183127, Addgene_65179, Addgene_183126, Addgene_110593, Addgene_110597), and dsRNA target sequence (Type 3 ...
-
bioRxiv - Microbiology 2023Quote: ... and pBTK401 (Type 8) (Addgene_65109, Addgene_183127, Addgene_65179, Addgene_183126, Addgene_110593, Addgene_110597), and dsRNA target sequence (Type 3 ...
-
bioRxiv - Bioengineering 2023Quote: ... Pae Type I Cascade plasmids encoding Csy1-Csy2 (Addgene #153942) and Csy3-VPR-Csy4 (Addgene #153943 ...
-
bioRxiv - Bioengineering 2023Quote: ... and Pae Type I Cascade System (Addgene #153942 and 153943), YAP-S5A (Addgene #33093 ...
-
bioRxiv - Genetics 2023Quote: ... an adenovirus helper plasmid (pAdΔF6; Addgene plasmid 112867), and an ITR-flanked AAV transgene expression plasmid AAV-CAG-eGFP (provided by Dr ...
-
bioRxiv - Molecular Biology 2023Quote: ... The type V Scytonema hofmanni (Sh)CAST was obtained from Addgene (#127922) [15] ...
-
bioRxiv - Neuroscience 2024Quote: Adeno-associated virus (AAV) type 2 carrying cre-dependent ChR2-eYFP (Addgene plasmid 20298 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The type I-B Anabaena variabilis ATCC 29413 CAST was sub-cloned from Addgene (#168137) [16] ...
-
bioRxiv - Bioengineering 2020Quote: ... either of the two cell types was subjected to Lipofectamine transfection with CMV-R-GECO1.2-mCherry (Addgene, Watertown ...
-
bioRxiv - Synthetic Biology 2021Quote: ... mTiam1(64-437)-tgRFP-SspB wild type were a gift from Brian Kuhlman (Addgene plasmid # 60411; http://n2t.net/addgene:60411; RRID:Addgene_60411, and Addgene plasmid # 60417 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The type I-F Vibrio cholerae HE-45 CAST was sub-cloned from Addgene (#130637 and #130633) [14] ...
-
bioRxiv - Cell Biology 2024Quote: Lentiviral-TOP/FOP-dGFP-reporters (wild-type consensus plasmid TOP: Addgene plasmid #14715; http://n2t.net/addgene:14715; RRID:Addgene_14715; inverted consensus plasmid FOP: Addgene plasmid # 14885 ...
-
bioRxiv - Cell Biology 2020Quote: ... of L-type Ca2+ channels was a gift from Diane Lipscombe (Addgene plasmid # 26572; http://n2t.net/addgene:26572; RRID:Addgene_26572). The mApple-myosin X was subcloned by the Protein Cloning and Expression Core facility of the MBI.
-
bioRxiv - Neuroscience 2022Quote: The pCMV-hEAAT2 plasmid encoding the human excitatory amino acid transporter type 2 (EAAT2) was a gift from Susan Amara (Addgene plasmid # 32814; http://n2t.net/addgene:32814; RRID:Addgene_32814). The cDNA was subcloned into pcDNA3 between KpnI and XbaI restriction sites and under the T7 promoter for expression in Xenopus laevis oocytes ...
-
bioRxiv - Neuroscience 2023Quote: ... We used the following viral constructs and injection volumes per site in the different types of experiments: AAV.9.Syn.Flex.GCaMP6f.WPRE.SV40 (calcium recordings 140 nl; Addgene, no. 100833); AAV.1.hSyn.dio.EGFP (anterograde labelling ...
-
bioRxiv - Molecular Biology 2022Quote: ... Synthetic cell type specific promoters were obtained from the following Addgene plasmids: 161_pAAV-ProD5-CatCh-GFP-WPRE (Addgene plasmid # 125981 ...
-
bioRxiv - Cancer Biology 2022Quote: Lentiviral particles from plentiCRISPRv2 and retroviral particles from pBabe-hygro-GFP (RRID:Addgene_61215) were produced in 293T cells as described26,27 ...
-
bioRxiv - Neuroscience 2021Quote: ... C57BL/6 mice were injected with the AAV5-CAG-ChR2-mCherry adenovirus (200 nL, Addgene) in the PC ...
-
bioRxiv - Cell Biology 2020Quote: ... The plasmid containing the α1C subunit (CaV1.2) of L-type Ca2+ channels was a gift from Diane Lipscombe (Addgene plasmid # 26572 ...
-
bioRxiv - Cell Biology 2024Quote: ... enables GFP and APEX to be targeted to cilia in many cell types via the N-terminal 203 residues of NPHP3 and was a gift from Maxence Nachury (RRID:Addgene_73186) (Mick et al ...
-
bioRxiv - Neuroscience 2022Quote: The pCMV-hEAAT2 plasmid encoding the human excitatory amino acid transporter type 2 (EAAT2) was a gift from Susan Amara (Addgene plasmid # 32814 ...
-
bioRxiv - Physiology 2022Quote: ... (Gagoski et al., 2016) or the rhodopsin-muscarinic receptor type 1 chimera (opto-M1R) (Morri et al., 2018) were purchased from Addgene (plasmids 67130 and 106069 respectively ...
-
bioRxiv - Cell Biology 2021Quote: ... The adenovirus plasmid encoding EGFP-tubulin (pShuttle-EGFP-tubulin) was a gift from Torsten Wittmann (Addgene plasmid #24327 ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293 cells were co-transfected with plasmids encoding wide-type myc-human TREM2 and GFP-human TDP-43 (residues 216-414, Addgene, 28197) or GFP control by the calcium phosphate precipitation method ...
-
bioRxiv - Molecular Biology 2023Quote: Plasmids for type I-F CASTs Cascade over-expression were constructed by sub-cloning the individual genes into pRSFDuet1 (Addgene #126878) to create pIF1008 ...
-
bioRxiv - Cell Biology 2022Quote: ... The lentiviral particles of shZDHHC5 (target sequence 5’CCCAGTTACTAACTACGGAAA3’ in pLKO.1 vector) and empty pLKO.1 (Addgene, 8453) were packaged in HEK293T cells and used to transduce PCDH7-GFP-BAC cells ...
-
bioRxiv - Cancer Biology 2019Quote: ... the wild-type and Δ365-371 mutant CELF1 were cloned in the pET His10 TEV LIC cloning vector (2B-T-10) (Addgene, Cambridge, MA) using NEBuilder HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... AAV1 particles (Addgene, Cat # 100836-AAV1) carrying CAG-driven GCaMP6f Ca2+ sensor was added in medium for 16 - 24 hours at 37°C ...
-
bioRxiv - Bioengineering 2022Quote: Assembloids were formed with VTA- and PFC-like spheroids such that one spheroid type was transduced with AAV9-GCaMP6f (Addgene, cat# 100836-AAV9) while the other was transduced with either an inhibitory or excitatory DREADDs virus (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ... The adenovirus was constructed by subcloning the existing E-cadherin tension sensor into the pShuttle-CMV vector (Addgene, 16403), followed by recombination into the pAdEasy1 vector (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ... The adenovirus plasmid encoding EGFP-tubulin (pShuttle-EGFP-tubulin) was a gift from Torsten Wittmann (Addgene plasmid #24327, RRID:Addgene_24327, [86]) and adenovirus was produced by the University of Michigan Vector Core.
-
bioRxiv - Neuroscience 2021Quote: ... Gad2-Cre mice received a stereotaxic injection (200 nL) of the AAV5-CAG-Flex-ChR2-tdTomato adenovirus (Catalog #18917, Addgene) into the MCPO ...
-
bioRxiv - Neuroscience 2023Quote: ... had the PiCo neurons successfully transfected by pAAV-hSyn Con/Fon hChR2(H134R)-EYFP adenovirus vector (cat# 55645-AAV8; AddGene, USA ...
-
bioRxiv - Neuroscience 2023Quote: ... had successful transfection of PiCo neurons by using a pAAV-hSyn Con/Fon hChR2(H134R)-EYFP adenovirus vector (cat# 55645-AAV8; AddGene, USA ...
-
bioRxiv - Cancer Biology 2022Quote: Retroviral particles from pMIG Bcl-xL (Addgene #8790), and lentiviral particles from pLenti6.3/TO/V5 containing IDH1R132H,13 or pLentiCRISPRv2 (Addgene #52961 ...
-
bioRxiv - Microbiology 2021Quote: Lentiviral particles harboring SIRT6 overexpression vector (pCDH; Addgene) or sirt6 shRNA expression vector (pLKO.1 ...
-
bioRxiv - Neuroscience 2021Quote: Lentiviral particles were generated using the psPAX2 (RRID: Addgene_12260) and pMD2.G plasmids (RRID ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral particles carrying plenti6-H2B-mCherry (Addgene plasmid #89766 58) were generated by transient transfection of Hek293T cells together with the corresponding envelope and packaging vectors ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV2-hSyn-DIO-hM3D(Gq)-mCherry (5.8 × 1012 particles/mL; Addgene, Catalog number 44361-AAV2 ...
-
bioRxiv - Genetics 2020Quote: ... Lentiviral particles were generated in 293T cells using pMDG.2 (Addgene) and psPAX2 (Addgene ...
-
bioRxiv - Pathology 2021Quote: Adeno-associated viral particles were purchased from Addgene (Watertown, Massachusetts, USA). TBG-Cre (AAV.TBG.PI.Cre.rBG ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lentiviral particles were produced by transient transfection of psPAX2 (Addgene #12260), pMD2.G (Addgene #12259) ...
-
bioRxiv - Neuroscience 2020Quote: ... carrying the fluorescent calcium indicator GCaMP6f (AAV.Syn.Flex.GCaMP6f.WPRE.SV40, 1E13 particles/ml, Addgene) into the left VTA (AP ...
-
bioRxiv - Neuroscience 2022Quote: ... or AAV5-hSyn-DIO-mCherry (1012 particles/mL, plasmid #50459, Addgene) in the SNc of TH::Cre rats (20,21) ...