Labshake search
Citations for Addgene :
101 - 150 of 2276 citations for 7 Methylimidazo 1 2 a pyridine 6 boronic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... 1.0 µL of pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (diluted 1:2 in dPBS; Addgene: 100845-AAV5 ...
-
bioRxiv - Neuroscience 2023Quote: ... The sequence for L7-6 was obtained from pAAV/L7-6-GFP-WPRE (Addgene plasmid #126462) and ordered as a gBLOCK (IDT) ...
-
bioRxiv - Developmental Biology 2022Quote: ... psPAX2 (6 µg, Addgene plasmid # 12260) and pAdVAntage (3 µg ...
-
bioRxiv - Microbiology 2022Quote: ... 6 μg psPAX2 (Addgene, plasmid 12260) and 4 μg pMD2.G (Addgene ...
-
bioRxiv - Biophysics 2019Quote: The plasmids mEmerald-Zyxin-6 (Addgene plasmid # 54319 ...
-
bioRxiv - Developmental Biology 2021Quote: ... psPAX2 (6 µg, Addgene plasmid # 12260) and pAdVAntage (3 µg ...
-
bioRxiv - Cancer Biology 2022Quote: ... 6 μg of psPAX2 (12260; Addgene), and 3 μg of pVSVg (8454 ...
-
bioRxiv - Microbiology 2022Quote: ... 6 µg PMD2.G (Addgene, 12259), 18µg PsPAX2 (Addgene ...
-
bioRxiv - Developmental Biology 2022Quote: ... psPAX2 (6 μg, Addgene plasmid # 12260) and pAdVAntage (3 μg ...
-
bioRxiv - Cancer Biology 2024Quote: ... 6 μg pMD2.G (Addgene, 12259), 4 μg pUMVC (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... 6 μg psPAX2 (Addgene, plasmid 12260) and 4 μg pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
bioRxiv - Cell Biology 2019Quote: ... mRuby-Lifeact-7 was a gift from Michael Davidson (#54560, Addgene). One day after transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... and EBFP2-Nucleus-7 (Addgene #55249, a gift from Michael Davidson). The targeting sequences for the nucleus ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV2-retro-AAV-CAG-tdTomato (Addgene, 7×10^12 gc/ml), Cholera toxin subunit B CF-640 (Biotium ...
-
bioRxiv - Cell Biology 2020Quote: ... and mCherry-Cx43-N-7 were gifts from Michael Davidson (Addgene plasmids # 55112 ...
-
bioRxiv - Cell Biology 2022Quote: ... mCherry-Lifeact-7 was a gift from Michael Davidson (Addgene, 54491).
-
bioRxiv - Cell Biology 2022Quote: ... The mCherry-EB3-7 vector was obtained from Addgene (addgene #55037) and the mCherry was removed and replaced by a GFP sequence using AgeI/BsrG1 restriction enzymes ...
-
bioRxiv - Neuroscience 2023Quote: ... mKeima-Red-Mito-7 was a gift from Michael Davidson (Addgene plasmid # 56018 ...
-
bioRxiv - Neuroscience 2022Quote: ... or AAV2retro-CaMKIIa-stGtACR2-FusionRed (Addgene 105669, 7 × 1012 VG/ml) were made unilaterally into right spinal cord gray matter at C7/C8 (0.5 mm lateral ...
-
bioRxiv - Neuroscience 2023Quote: ... 7×10¹² genome copies per ml) viruses were purchased from Addgene.
-
bioRxiv - Microbiology 2021Quote: ... Expression vectors for SARS-CoV-2 Wuhan-Hu-1 (Addgene, #149539), SARS-CoV-2 B.1.167.2 (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: ... gRNA-1 and -2 were cloned into pL-CRISPR.EFS.GFP (Addgene, #57818) and pL-CRISPR.EFS.tRFP (Addgene plasmid #57819) ...
-
Zero-shot learning enables instant denoising and super-resolution in optical fluorescence microscopybioRxiv - Bioengineering 2023Quote: ... and the sgRNA was ligated into pX330A-1×2 (Addgene, 58766). To construct donor vector ...
-
bioRxiv - Genomics 2022Quote: ... and pSLQ1852-2 pHR: U6-SpsgCD95-1 CMV-EGFP (Addgene 84151) with slight modifications ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were plated in 6-well plate and co-transfected with SBE4-Luc plasmid (1 μg, Addgene,16495) and pDEST26-Renilla plasmid (0.1 μg ...
-
bioRxiv - Neuroscience 2024Quote: ... All rats received bilateral microinjections of AAV2.CMV::nNOS-shRNA-EGFP or AAV2.CMV::luciferase-shRNA-EGFP (USC viral vector core: titer∼∼7×1013 vg/mL) combined with an AAV2.CAG::Flex-Ruby2sm-Flag.WPRE.SV40 (Addgene: titer: ∼1×1012 vg/ml) into the NAc ...
-
bioRxiv - Immunology 2019Quote: ... and 6-His tag (Addgene plasmid# 50803) [36] ...
-
bioRxiv - Cell Biology 2020Quote: 6×His-tagged VHH-mCherry (Addgene #109421) was transformed into BL21DE3 E.coli cells ...
-
bioRxiv - Genomics 2021Quote: ... and pMD2.G (Addgene, 12259, 6 µg) using calcium phosphate precipitation (62) ...
-
bioRxiv - Neuroscience 2019Quote: ... 6 μg pSAD-∆G-F3 (Addgene, 32634) with different fluorescent protein genes and helper plasmids (3 μg pcDNA-SADB19N (Addgene ...
-
bioRxiv - Pathology 2021Quote: ... and 6 μg pMD2.G (Addgene 12259) or pEC120-S-D19-V5 ...
-
bioRxiv - Cell Biology 2021Quote: ... gonads of young adult BOX428 animals were microinjected with 30 ng/μl Pelt-2::αGFP-NB::ZIF-1 and 2.5 ng/μl Pmyo-2::GFP (#Addgene 26347) as a co-injection marker ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA 2 (shYAP1 #2) or scramble shRNA (shNC) were inserted into pLKO.1-TRC Cloning Vector (Addgene, 10878, RRID: Addgene_10878) following the manufacturer’s protocol and sequenced ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA 2 (shYAP1 #2) or scramble shRNA (shNC) were inserted into pLKO.1-TRC Cloning Vector (Addgene, 10878, RRID: Addgene_10878) following the manufacturer’s protocol and sequenced ...
-
bioRxiv - Cell Biology 2019Quote: The Polo-like binding domain (PBD) of PLK1 (amino acid 326 to amino acid 603) was amplified from the pTK24 plasmid (Addgene) and cloned into a pT7-His6-SUMO expression vector using NEB Gibson assembly (Gibson Assembly Master Mix ...
-
bioRxiv - Cell Biology 2021Quote: ... mEos2-Actin-7 was a gift from Michael Davidson (Addgene plasmid # 57339)(87) ...
-
bioRxiv - Neuroscience 2020Quote: ... 7 mice) or AAV2-hSyn-DIO-mCherry (4.7 × 1012 particles/mL; Addgene, Catalog number 50459-AAV2 ...
-
bioRxiv - Neuroscience 2019Quote: ... mCherry-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54491)
-
bioRxiv - Molecular Biology 2021Quote: ... The 8x let-7 BS psiCHECK2 plasmid was acquired from Addgene (#20931), and the 3x miRNA BS psiCHECK2 plasmids (used in Suppl ...
-
bioRxiv - Molecular Biology 2020Quote: ... or empty EGFP plasmid and an mRaspberry-Mito-7 plasmid (Addgene #55931) to localize mitochondria ...
-
bioRxiv - Immunology 2020Quote: ... mCardinal-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid #54663). Transfection with plasmid was performed following standard protocols for Fu gene 6 (Promega ...
-
bioRxiv - Neuroscience 2019Quote: ... an eGFP-only reporter without DREADDs (n=7; Addgene: AAV2-hSyn-eGFP), was employed in a group of control rats [65–67].
-
bioRxiv - Biochemistry 2019Quote: ... WT αSyn/pT7-7 plasmid was procured from Addgene (www.addgene.com; plasmid #36046). This vector was also used as a backbone for cloning His6-tagged WT-αSyn by PCR amplification.
-
bioRxiv - Cell Biology 2021Quote: ... EBFP2-Mito-7 was a gift from Michael Davidson (Addgene plasmid # 55248) [39] ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The CaMV terminator was isolated from the PABE-7 plasmid (Addgene #115628) [28] and cloned into an entry vector via Gibson assembly.
-
bioRxiv - Developmental Biology 2023Quote: ... TdTomato-LifeAct tdTomato-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54528 ...
-
bioRxiv - Cell Biology 2023Quote: ... AICSDP-7:SEC61B-mEGFP (Addgene plasmid # 87426; http://n2t.net/addgene:87426; RRID:Addgene_87426).
-
bioRxiv - Biochemistry 2023Quote: ... and transfected with plasmids encoding either mCherry-Golgi-7 (Addgene, Watertown, MA), mCherry-ER-3 (Addgene ...
-
bioRxiv - Microbiology 2023Quote: 4e5 VeroE6 cells were plated in 6-well plates and transfected with 1 μg VSV-G plasmid (Addgene #8454) via TransIT-X2 (Mirus) ...