Labshake search
Citations for Addgene :
101 - 150 of 3231 citations for 7 8 Dimethoxy 2 3 4 5 tetrahydro 1H benzo e 1 4 diazepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... abcc9 gRNA (5’ CATTGCCACGAAGCTGGCGG 3’) or kcnj8 gRNA (5’ ACGCCACTTCAGGTCTACCA 3’) were cloned into BbsI digested plasmid pX330 (Addgene # 42230). T7 sgRNA template and T7 Cas9 template were prepared by PCR amplification and gel purification ...
-
bioRxiv - Cell Biology 2023Quote: ... two sequences targeting exon 1 of Numb (5’-GAAAGACGTTTATGTCCCAG-3’ and 5’-GGAAGCTACACTTTCCAGTG-3’) were individually cloned into plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988). These guide constructs were then electroporated into mESCs using the Lonza Nucleofector 2b Device and Cell Nucleofector Kit (Lonza #VAPH-1001) ...
-
bioRxiv - Immunology 2024Quote: ... targeting CYLD was cloned by annealing two DNA oligos (forward, 5’-GTGGTCAAGGTTTCACTGAC-3’; reverse, 5’-GTCAGTGAAACCTTGACCAC-3’) and ligating into lentiCRISPER v2 (52961, Addgene) plasmids ...
-
bioRxiv - Cell Biology 2024Quote: ... the primers 5’-CACCGCATCGCTCCTGCGTCCGCCA-3’ and 5’-AAACTGGCGGACGCAGGAGCGATGC-3’ were annealed and subcloned into px458-pSpCas9(BB)-2A-GFP (Addgene) using the BpiI restriction site to generate a guide RNA ...
-
bioRxiv - Synthetic Biology 2019Quote: We modified the vector pX330A_dCas9–1 × 4 (a gift from Takashi Yamamoto, Addgene plasmid #63598) by inserting a gBlock Gene Fragment (Integrated DNA Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: SUDHL-4 cell line was infected using pLKO.1-puro-GFP U6 sgRNA (Addgene #50920) containing BAX RNA guides or non-targeting RNA guide:
-
bioRxiv - Microbiology 2022Quote: ... pGBW-m4252984 (SARS-CoV-2 E [envelope]) was a gift from Ginkgo Bioworks (Addgene plasmid #153898 ...
-
bioRxiv - Neuroscience 2023Quote: The gcy-8p::gfp::egl-4 plasmid was constructed by replacing the promoter in the odr-3p::gfp::egl-4 plasmid (Addgene) with the AFD-specific gcy-8 promoter using standard restriction enzyme-mediated cloning ...
-
bioRxiv - Cancer Biology 2023Quote: ... E-cadherin reporter (pHAGE-E-cadherin-RFP, Addgene #79603), cell cycle reporter (pBOB-EF1-FastFUCCI-Puro ...
-
bioRxiv - Microbiology 2022Quote: ... and 4 μg pMD2.G (Addgene, plasmid 12259). 48 h post-transfection ...
-
bioRxiv - Systems Biology 2021Quote: ... and pX458-sgRNA_Ago1_3/4 (Addgene #73535 and #73536) plasmids (Ngondo et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... Plasmids pCXLE-hOCT3/4-shp53-F (Addgene #27077), pCXLE-hSK (#27078) ...
-
bioRxiv - Bioengineering 2022Quote: ... respectively (Supplementary Data 4, Addgene #183903 and #183904). For piggyBac integration near the Ae ...
-
bioRxiv - Cancer Biology 2019Quote: ... 4 µg of pCMV delta R8.2 (Addgene #12263) and 5 µg of vector (pCDH-CMV-MCS-EF1-GFP empty ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 4 µg of psPAX2 (Addgene, cat# 12260) using Lipofectamine 2000 Transfection Reagent according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4 µg of pVSV-G (Addgene, Plasmid #8454), and 10 µg of lentiviral plasmid of interest were used ...
-
bioRxiv - Cell Biology 2023Quote: ... and 4 μg pMD2.G (Addgene, plasmid 12259). 48 h post-transfection ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 μg of pCMV-VSV-G (Addgene #8454) and 7.5 μg of psPAX2 (Addgene #12260 ...
-
bioRxiv - Microbiology 2019Quote: ... TAAGATCTGTTTAGTGGTGATGGTGATGATGTTTTCCCTTTTGACCTGCGTG EphA2 sgRNA constructs oligos: 5-AAACGTGTGCGCTACTCGGAGCCTC-3 and 5-CACCGGAAGCGCGGCATGGAGCTCC-3 were annealed and ligated into a lentiGuide-Puro plasmid (Addgene, # 52963). EphA4 sgRNA constructs ...
-
bioRxiv - Microbiology 2019Quote: ... EphA4 sgRNA constructs: oligos 5-AAACCACAGTACATTTTTGGCACAC-3 and 5-CACCGTGTGCCAAAAATGTACTGTG-3 were annealed and ligated into a lentiGuide-Puro plasmid (Addgene, # 52963). Sequencing was performed for all constructs to confirm the correct sequence.
-
bioRxiv - Immunology 2021Quote: ... TPC2(L564P):GCaMP6s and TPC2(L265P/L564P):CaMP6s sequences were amplified (forward primer, 5’-TCCGAATTCAATGGGTTCTCATCATCATCATCATCA-3’, reverse primer, 5’-GATACCGGTTGCAACTTCGCTGTCATCATTTGTACAAAC-3’) and subcloned into mApple N1-vector (Addgene #54567) via EcoRI und AgeI sites.
-
bioRxiv - Neuroscience 2020Quote: ... via the primers 5’ GGAATTCATAGGGCGGCCGGGAA 3’ and 5’ AGCGCTGGCCGGCCGTTTAAAC 3’ and was cloned into plasmid AAV-PGK-Cre (Addgene plasmid # 24593) between the AfeI (NEB ...
-
bioRxiv - Genomics 2021Quote: ... two guide RNA sequences (gRNA 5’ TTGGGGGGGCTACTGCCAGC 3’ and 5’ CTTGAACGCCACCCTCTAAC 3’) were cloned into pspCas9(BB)-2A-GFP (Addgene; #48138) and pspCas9(BB)-2A-RFP (Addgene ...
-
bioRxiv - Molecular Biology 2021Quote: ... the annealed oligos to target CRY1 (Sense: 5′ CACCGCCTTCAGGGCGGGGTTGTCG 3′; and Antisense: 5′ AAACCGACAACCCCGCCCTGAAGGC 3’) was inserted into BsmBI of LentiCRISPRv2 plasmid (Addgene #: 52961).
-
bioRxiv - Pathology 2019Quote: ... the full length genomic copy with promoter of MoDNM1 was amplified with MoDnm1-F (5’-AATT GAATTC GTTGAGCAGGCCGAGCGAC-3’) and MoDnm1-R (5’-AATT GAATTC CACTGGCATTTGATTACGCAAGG-3’) inserted into pFGL822 (Addgene, 558226) and introduced into the Modnm1Δ strain.
-
bioRxiv - Biophysics 2019Quote: ... The LRRK2 gene was cloned by using the primer sets: 5’-GCGATAACATGGCTAGTGGCAGC-3’ and 5’-GGGGTTATGCTAGTTACTCAACAGATGTTCGTCTC-3’ with pENTR221-LRRK2 (Addgene #39529) as the template ...
-
bioRxiv - Molecular Biology 2021Quote: ... of plasmids expressing sgRNAs (5′- ATTGTGATATCCGATAGTGAT-3′ and 5′-GTTCTGTCAGTGTGAAGAGG-3′) and Cas9 followed by the 2A-Puromycin cassette (pX459, Addgene #62988). 24 h after transfection ...
-
bioRxiv - Cell Biology 2019Quote: ... the Bmal1 coding sequence was cloned from mouse embryonic cDNA (forward primer: 5’ GGCGAATTCGCGGACCAGAGAATGGAC 3’; reverse primer: 5’ GGGCTCGAGCTACAGCGGCCATGGCAA 3’) and subcloned into the pBABE retroviral expression vector (Addgene, 1764). Retroviral vectors were transfected into Phoenix packaging cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... gRNA sequences targeting Apc (5-CAACTTCTGGTAATGGTC-3) or Trp53 (5-AATGAGGCCTTGGAACTCA-3) were cloned into the Px330 vector (Addgene plasmid #42230). Organoids were removed from Matrigel using Dispase II (Gibco) ...
-
bioRxiv - Cell Biology 2023Quote: ... the primers 5’-AAACCTGGACCCCACCCCCAGATC-3’ and 5’-CACCGATCTGGGGGTGGGGTCCAG-3’ were annealed and cloned in the px458-pSpCas9(BB)-2A-GFP (Addgene, #48138) using the BpiI restriction site to generate a guide RNA ...
-
bioRxiv - Synthetic Biology 2023Quote: ... was PCR amplified from genomic DNA using primers (5’ CAGGTCTCAATCCCGATGTAGAACGCGAG 3’) and (5’ CGGTCTCACATATTGTTTCCTTTCTTTATTCACCGG 3’) and was cloned immediately upstream of SpCas9 amplified from plasmid PX165 (Addgene #48137) (62 ...
-
bioRxiv - Genomics 2023Quote: ... Guide RNAs (FANCC: 5’-GCAAGAGATGGAGAAGTGTA-3’ and MSH2: 5’-GTGCCTTTCAACAACCGGTTG-3’) were cloned into pSpCas9(BB)-2A-GFP (PX458) vector (Addgene#48138). AHH-1 cells were transfected using Lipofectamine 2000 (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2023Quote: ... The SIYx3-GFP insert was generated with the primers: 5’-GGTGTCGTGAGGATCCACCATGGTGTCTATTTACAGGTAC-3’ 5’-CGCCCTCGAGGAATTCTTACTTGTACAGCTCGTCCATGC-3’ and cloned into pLV-EF1a-IRES-Blast (Addgene #85133) linearized with BamHI and EcoRI restriction enzymes (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... mCherry-iLID was amplified using 5’-GGTAGTAGTGGTAGTAGTATGGTGAGCAAGGGCGA-3’ and 5’-TCGAAGCTTGAGCTCGAGATCTTTAAAAGTAATTTTCGTCGTTCGCT-3’.The fragments were inserted into a pEGFP-C1 vector (Addgene 46956) using the AgeI/BglII restriction sites.
-
bioRxiv - Neuroscience 2023Quote: ... PV-cre mice received unilateral injections in the left lobule simplex of 0.7 µl of pAAV-1-hSyn1-Flex-SIO-stGtACR2-FusionRed-dlox (N = 5, 2.0 × 1012 genome copies/mL; Addgene: 105677-AAV1), while another group of PV-cre mice received injections of pAAV-9/2-hSyn1-dlox-tdTomato-dlox-WPRE (N = 3 ...
-
bioRxiv - Neuroscience 2020Quote: ... the target sequence (5’-GGGTGAAGATCCTGTTCAATA-3’) was shuttled to the pLKO.1-Hygromycin vector (Addgene, #24150). For human astrocytes ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 μL of plasmid DNA (tdTomato-Lifeact-7, 500 ng/ μL, Addgene, 54528), and 96 μL of PBS ...
-
bioRxiv - Biophysics 2021Quote: ... Fractions containing the target proteins were dialyzed against PBS (pH 7.4) and the His6-SUMO-tag was removed by enzymatic cleavage using human SENP1 protease at 4°C overnight (Addgene #16356) (51) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Laccase2 Exons 1-3 (Hy_pMT Laccase2 Exons 1-3; Addgene #91799), and nLuc (Hy_pMtnA nLuc SV40 ...
-
bioRxiv - Neuroscience 2024Quote: ... The he1.1:YFP cassette (he1.1:YFP_F, he1.1:YFP_R, Table 4) was amplified from p3E_he1a:YFP (Addgene, plasmid #113879), and the polyA terminator (polyA_F ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... for the Right Arm (5’-TACATCCCTAAGGCCTGATTACCCGAACACT-3’, 5’-TATACGCGTTGCCATGCTATTGGCTTC-3’) and cloned into pHD-DsRed-attp (Gratz et al., 2014; Addgene Plasmid # 51019) in two steps ...
-
bioRxiv - Cell Biology 2021Quote: ... human MCOLN1 was amplified by PCR with the following oligonucleotides with overhangs (underlined): 5’-GACACCGACTCTAGAATGGTGAGCAAGGGCGAGGAGC-3’ (forward) and 5’-AACTAGTCCGGATCCTCAATTCACCAGCAGCGAATGC-3’ (reverse) from Mucolipin1-pEGFP C3 (Addgene plasmid #62960) construct and subcloned into XbaI and BamHI restriction sites of pLenti-CMV-MCS-GFP-SV-puro (Addgene plasmid #73582 ...
-
bioRxiv - Cancer Biology 2021Quote: ... by introducing one or two guide RNAs (5′-GTTGGCTCGCCGGATACGGG-3′ for H3f3b; 5′-ACTCCAGTCTTTCTAGAAGA-3′ for Rosa26) into LentiCRISPR v2 (Addgene plasmid #52961) and LentiCRISPRv2 hygro (Addgene Plasmid #98291) ...
-
bioRxiv - Cell Biology 2022Quote: A sgRNA construct targeting exon 2 of the human ACLY gene was made by inserting annealed, phosphorylated oligonucleotides (5′-CACCGGAATCGGTTCAAGTATGCTC-3′, 5′-AAACGAGCATACTTGAACCGATTCC-3′) into pSpCas9(BB)-2A-Puro (PX459, Addgene, plasmid 48139). The sgRNA construct was then transfected (2 μg ...
-
bioRxiv - Systems Biology 2019Quote: ... we performed inverse PCR using F primer (5’-TGAGCGGCCGCTAGGTACCTTTAA-3’) and R primer (5’-GGCACCGGGCTTGCGGGTCATGCA-3’) and pKLV-U6gRNA-EF(BbsI)-PGKpuro2ABFP (Addgene, Plasmid #62348) as a template ...
-
bioRxiv - Microbiology 2020Quote: ... targeting ACE2 (5’-TGGATACATTTGGGCAAGTG −3’) and one targeting B4GALT7 (5’-TGACCTGCTCCCTCTCAACG-3’) was cloned into the lentiGuide-Puro plasmid (Addgene plasmid #52963) following published procedure (Sanjana et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... The fragment has been amplified using the primers F-5’-TGCAGGATCCCATCGATTCGGCCACCATGAAACGGACAG -3’ and R-5’-TAGAGGCTCGAGAGGCCTTGTCAGACTTTCCTCTTCTTCTTGG -3’) from the pCAG-CBE4max-SpG-P2A-EGFP plasmid (Addgene plasmid #139998)14 and from the pCAG-CBE4max-SpRY-P2A-EGFP plasmid (Addgene plasmid #139999)14.
-
bioRxiv - Genetics 2020Quote: ... oligonucleotides for gRNA synthesis (5’ TAGGAGGAAACTGTGCTCTTCA 3’ and 5’ AAACTGAAGAGCACAGTTTCCT 3’) were annealed and ligated into plasmid pDR274 (Addgene #44250, Watertown, MA). Purified plasmid DNA was digested with DraI (New England BioLabs ...
-
bioRxiv - Immunology 2023Quote: ... Next the LentiGuide-Puro plasmid [49] was used to express a single-guide RNA (CD58 sgRNA; 5’-GAGCATTACAACAGCCATCG-3’ and ICAM4 sgRNA: 5’-CCGGGAACACCTGCGTCACG-3’) LentiGuide-Puro (Addgene plasmid # 52963) was a gift from Feng Zhang ...
-
bioRxiv - Microbiology 2022Quote: ... to co-transfect plasmids containing cDNAs for SARS-CoV-2 E protein (pGBW-m4133502, Addgene) and green fluorescent protein (GFP ...