Labshake search
Citations for Addgene :
101 - 150 of 2141 citations for 6 Phenyl 1H imidazo 1 2 b pyrazole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... doublefloxed.hChR2(H134R).EYFP.WPRE-HGHpA (diluted 1:2 with dPBS; Addgene number: 20298) was injected into auditory cortex as described above in ChAT-Cre animals ...
-
bioRxiv - Cancer Biology 2023Quote: ... AAACTCGGAGTTCTCAGAGCCCAGC NFKB2 guide #1 F: CACCGTGGCCCCTACCTGGTGATCG NFKB2 guide #1 R: AAACCGATCACCAGGTAGGGGCCAC NFKB2 guide #2 F: CACCGCTTTCGGCCCTTCTCACTGG NFKB2 guide #2 R: AAACCCAGTGAGAAGGGCCGAAAGC pLKO.TRC (Addgene; Cat#10878) was used for generating shNMNAT1 KD in U-87 MG and U-251 MG cell lines ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected with mCherry – clathrin light chain B (Addgene Plasmid #55019) and EGFP – clathrin light chain A52 plasmids ...
-
bioRxiv - Cell Biology 2021Quote: ... U2OS cells expressing the Mis12-targeted Aurora B FRET sensor (Addgene, #45231) or photoactivatable GFP-α-tubulin (plasmid provided by Alexey Khodjakov ...
-
bioRxiv - Microbiology 2023Quote: ... pcDNA3.1-3xmyc-B-NLRC5 (Addgene plasmid #37509; http://n2t.net/addgene:37509; RRID:Addgene_37509), and pcDNA3.1-3xmyc-B-NLRC5 iso3 (Addgene plasmid #37510 ...
-
bioRxiv - Immunology 2023Quote: ... pcDNA3.3-SARS2-B.1.617.2 (Delta) was a gift from David Nemazee (Addgene plasmid #172320 ...
-
bioRxiv - Cancer Biology 2020Quote: ... to co-transfect pBABE-puro or pBABE-puro.SLX4IP.3xFLAG with pCMV-VSV-G (at a ratio of 6:1, Addgene#8454) into GP2-293 cells (Clontech) ...
-
bioRxiv - Bioengineering 2020Quote: ... 400,000 HEK cells were seeded in 6-well plates and the next day transfected with 1 μg psPAX2 (Addgene #12260), 3 μg pCMV-VSV.G (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were transfected with a 6:1 ratio of a firefly luciferase reporter plasmid driven by a pGL3-RARE-responsive promoter (Addgene) and a Renilla luciferase reporter plasmid driven by a constitutive CMV promoter (Promega) ...
-
bioRxiv - Neuroscience 2022Quote: ... 6 mice from each line were injected bilaterally with a pAAV9-CAG-Flex.GCaMP6s.WPRE.SV40 virus (Addgene, titre ≥ 1×1013 vg/mL) in the medial NAc shell (D1-cre and D2(A2a)-cre mice ...
-
bioRxiv - Developmental Biology 2023Quote: ... expressing a dominant negative variant of the rol-6 gene and an empty vector pSK (up to 200 ng μl-1 of DNA) (Addgene) using standard methods (42) ...
-
bioRxiv - Cell Biology 2020Quote: ... and envelope (6 μg pMD2.G, Addgene #12259) viral plasmids were diluted in 500 μL serum-free DMEM ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 6 μg of psPAX2 (Addgene, Cat #12260) into a 10 cm plate of HEK293T cells at 60-70% using Fugene 6 transfection reagent (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: ... the murine shRNA hairpins pLKO.1-shCdkn2a #1 (TRCN0000077816) and #2 (TRCN0000362595) and the human and murine pLKO.1-shGFP control (Addgene, cat#30323) vectors were packaged using the ViraPower Kit (Invitrogen ...
-
bioRxiv - Biophysics 2021Quote: ... a pRSFDuet-1 plasmid containing His6-SUMO SARS-CoV-2 nsp12 (Addgene #159107) was transformed into E ...
-
bioRxiv - Biophysics 2021Quote: ... the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E ...
-
bioRxiv - Biophysics 2022Quote: ... the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E ...
-
bioRxiv - Genetics 2019Quote: pCFD3-frame_selector_(0, 1, or 2) plasmids (Addgene #127553-127555, DGRC #1482-1484) were cloned by ligating annealed oligos encoding sgRNAs that target the CRISPaint target site (Schmid-Burgk et al ...
-
bioRxiv - Neuroscience 2021Quote: ... 500–550 nl of AAV9-Syn-jGCaMP7f-WPRE virus (diluted 1:2; Addgene) was injected in dorsal CA1 to express synapsin-driven calcium sensor jGCaMP7f (injection coordinates ...
-
bioRxiv - Cell Biology 2022Quote: ... 1–2 (lenti-TRE3G-ApaLI(*)-Hygro) were cloned into LT3REVIR (Addgene Plasmid #111176) by inserting mito-ApaLI(* ...
-
bioRxiv - Neuroscience 2023Quote: ... diluted to 1/2) or AAV-Ef1a-mCherry (#114470-AAV9, obtained from Addgene; titer ...
-
bioRxiv - Cell Biology 2023Quote: ... YAP-targeting shRNA vectors 1 and 2 refer to pLKO1-shYAP1 (Addgene, #27368) and pLKO1-shYAP2 (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.50 µL of AAV5.FLEX.ArchT.tdTomato (diluted 1:2 with dPBS; Addgene number: 28305) was injected in basal forebrain of ChAT-Cre animals using the coordinates described above ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV8-Ef1a-DIO-mCherry (gift from B. Roth; Addgene viral prep # 50459-AAV8)(Krashes et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... PH-PLCδ1-GFP (#51407) and mCherry-VAP-B (#108126) were purchased from Addgene, pTagRFP-C (#FP141 ...
-
bioRxiv - Microbiology 2023Quote: ... pMB1-B-recA was recombined with pMB1-A-pBAD-dCas9 (Addgene number: 190132) in the target plasmid pMB2a-tet (a modified version of Addgene number ...
-
bioRxiv - Biochemistry 2024Quote: ... It was cloned into 438-B vector (kind gift from Scott Gradia; Addgene plasmid # 55219 ...
-
bioRxiv - Neuroscience 2020Quote: Stereotaxic injection of AAV-EF1a-DIO-HChR2(H134R)-eYFP (serotype 2/1 or 2/9, U. Penn Vector Core, Philadelphia, PA, USA or Addgene, Watertown, MA, USA) was performed in 6-8 weeks old DAT-IRES-Cre or FoxP2-Cre transgenic mice ...
-
bioRxiv - Immunology 2021Quote: ... HEK293T cells were seeded in 6-well plates and the next day transfected with 1 μg psPAX2 packaging plasmid (Addgene 12260), 500 ng pMD2.G VSV-G envelope plasmid (Addgene 12259 ...
-
bioRxiv - Genomics 2022Quote: ... Each 15-cm2 plate was transfected with a total of 21 μg of plasmid DNA (1:2:1 ratio psPAX2-D64V:pLenti-STARR:pLAI-Env) [psPAX-D64V (Addgene #63586), and pLAI-HIV (Addgene #133996)] ...
-
bioRxiv - Biochemistry 2020Quote: ... Human ACE2 plasmid was obtained from Addgene (#1786, (6)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 6 μg of psPAX2 packaging plasmid (Addgene plasmid #12260), and 2 μg pMD2.G envelope plasmid (Addgene plasmid #12259) ...
-
bioRxiv - Cell Biology 2022Quote: ... Dynamin 2-mTFP1 (or dynamin 1-mTFP1) construct was created by replacing the EGFP tag of dynamin 2-EGFP (or dynamin 1-EGFP, Addgene) with mTFP1 (Addgene) ...
-
bioRxiv - Bioengineering 2022Quote: ... Each shRNA was cloned into the host pLKO.1-puro vector. PLKO-shFOXA1#1 (Cat. #: 70095) and PLKO-shFOXA1#2 (Cat. #: 70096) were obtained from Addgene, and previously used 45 ...
-
bioRxiv - Cell Biology 2023Quote: PARP-1 sgRNAs (#1, GTGGCCCACCTTCCAGAAGC; #2, ATACCAAAGAAGGGAGT-AGC) were synthesized and subcloned into lenti-CRISPR vector (Addgene, pXPR_001, plasmid 49535). Lentiviral vectors were co-transfected into HEK293FT cells with the lentivirus packaging plasmids pVSVg and psPAX2 using FuGENE® HD ...
-
bioRxiv - Neuroscience 2023Quote: ... slices were virally infected with 0.5-1 µl AAV mixture per slice (containing AAV9-Camk2a-Cre at 2 × 1012 vg/ml (1:1000 dilution, Addgene and rAAV8-DIO-CBA-pAAIP2-mEGP at 4.2 x 1012 vg/ml ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... of a virus driving expression of membrane-targeted mCherry under control of the GFAP promoter (AAV5/GFAP-hM3dq-mCherry, University of Zurich, Figs. 1-5 or AAV5/GfaABC1D-Lck-GFP, Addgene, Fig. 6) in the NAcore (+1.5mm AP ...
-
bioRxiv - Molecular Biology 2024Quote: The HTLV-1 CA (Gag amino acids 132-349) was cloned into the 6×His SUMO bacterial expression plasmid (pHYRSF53, Addgene, Watertown, MA), with mutants created by using the Gibson assembly procedure ...
-
bioRxiv - Biochemistry 2021Quote: ... pAcGHLT-B-DDB1 (plasmid #48638) and pET28-UBA1 (plasmid #32534) were obtained from Addgene. The pOPC-UBA3-GST-APPBP1 co-expression plasmid ...
-
Kinetochore- and chromosome-driven transition of microtubules into bundles promotes spindle assemblybioRxiv - Cell Biology 2022Quote: ... unlabeled HeLa-TDS cells were transfected with CENP-B-INCENP-GFP (Addgene, plasmid #45238), and for live-cell imaging also with mCherry-PRC1 plasmid provided by Casper C ...
-
bioRxiv - Microbiology 2021Quote: ... cerevisiae expression vector (12URA-B) was a gift from Scott Gradia (Addgene plasmid #48304) a plasmid expressing human TOP2α was kindly provided by the James Berger (John Hopkins School of Medicine ...
-
bioRxiv - Cell Biology 2019Quote: ... Human B-Raf under T7 promoter was a gift from Dustin Maly (Addgene #40775) and was further modified by the insertion of two additional FLAG tags and of an RBS sequence ...
-
bioRxiv - Molecular Biology 2021Quote: ... laevis b-globin 5′- and 3′-UTR sequences were obtained from pT7TS (Addgene #17091). Mouse Malat1 3′ sequence was obtained from the Comp.25 mutant plasmid (Wilusz et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... PCR amplified ScTop2 and HsTOP2α cDNAs were inserted into the 12URA-B (Addgene #48304) yeast expression vector while HsTOP2β was inserted into the 12URA-C (Addgene #48305 ...
-
bioRxiv - Molecular Biology 2023Quote: ... CAST I-B system’s proteins and inverted repeat constructs were sub-cloned from Addgene plasmids #168137 and #168146 to generate pIF1003.
-
bioRxiv - Microbiology 2023Quote: ... and pcDNA3.1-3xmyc-B-NLRC5 iso3 (Addgene plasmid #37510; http://n2t.net/addgene:37510; RRID:Addgene_37510) were gifts from Thomas Kufer ...
-
bioRxiv - Immunology 2023Quote: ... pTwist-SARS-CoV-2D18 B.1.1.529 (Omicron) was a gift from Alejandro Balazs (Addgene plasmid #179907 ...
-
bioRxiv - Neuroscience 2023Quote: We used AAV1-hSyn-GCaMP6f (2 × 1013 vg/mL Penn Vector Core/Addgene; diluted 1:8 to 1:15 in saline) for experiments involving two-photon calcium imaging of V1 layer 2/3 cells ...
-
bioRxiv - Neuroscience 2024Quote: ... Pups were injected unilaterally with 1 μl of AAV9-hSyn-DIO-ChrimsonR-mRuby2-ST (2 × 1012 gc ml−1; Addgene #105448) or 1 μl of AAV9-CAG-Flex-ArchT (2 × 1012 gc ml−1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and then were inserted into pBP-Gal80Uw-6 (#26236, Addgene) via an L-R reaction with GATEWAY LR clonase II plus enzyme mix (12538120 ...