Labshake search
Citations for Addgene :
101 - 150 of 3082 citations for 6 Chloro 2 4 chlorophenyl N N dimethylimidazo 1 2 α pyridine 3 methanamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... H-RASV12 from pBABE-Puro H-RASV12 (n°12545 Addgene) was cloned in a home-made inducible vector derived from pLVX-Tight-Puro (Clontech ...
-
bioRxiv - Genetics 2023Quote: ... for CTCF and mEmerald-RAD21-N-18 (Addgene Plasmid #54248) for RAD21 ...
-
bioRxiv - Neuroscience 2021Quote: ... were added to each well along with 1 μl of Syn1-EBFP-Cre (serotype, 2-1; titer, 6×1012 genomes/mL; MOI, ∼8-0.08; Addgene, 51507-AAV1) delivered at full strength or diluted 1:103-104 ...
-
bioRxiv - Cancer Biology 2019Quote: ... GDI2 (crGDI2-1 Fw 5’ GCCACCCGAGTCAATGGGGA 3’ and crGDI2-2 Fw 5’ CACTCTCTCCTCCGTACGTA 3’) into a lentiviral CAS9 expressing plasmid (Addgene Plasmid # 49535) using the BSMB1 restriction sites ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sgRNA pairs were manually selected from the output list and cloned into the pGECKO backbone (CRISPRi.1: 5’ GTTACTTCCAACGTACCATG 3’, CRISPRi.2: 5’ CCTGTACCCCCATGGTACGT 3’) (Addgene 78534; (68))
-
bioRxiv - Cancer Biology 2022Quote: ... or with both 2 μg mCherry and 6 μg pCBASceI (Addgene, Plasmid 26477). The cells were incubated overnight in 1 ml of media containing DMSO for the controls ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2×106 mEF-depleted cells were transfected with sgRNAs 2+3 and pCas9_GFP (a gift from Kiran Musunuru, Addgene #44719). To generate Chaserrb/b mESCs ...
-
bioRxiv - Cancer Biology 2019Quote: ... A mixture of 3 transfection plasmids were produced by combining 2 µg pMDG.2 (Addgene #12259) (Addgene, Watertown, Massachusetts, USA); 4 µg of pCMV delta R8.2 (Addgene #12263 ...
-
bioRxiv - Microbiology 2021Quote: ... 8 × 105 293 T cells in a 6 cm dish were cotransfected with 2 μg of HIV-1 packaging plasmid pCMVΔ8.2 R (Addgene # 12263); 0.5 μg of the pCMV-VSV-G plasmid (Addgene # 8454 ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were subcultured twice a week at a ratio of 1:5 to 1:8.Transient transfection of HeLa cells (1–2 x 105 cells/6-well) with pcDNA3.1(+) NAPstar or pSC2 HyPer7 (Addgene; plasmid #136466 ...
-
bioRxiv - Immunology 2023Quote: ... N-MLV reporter viruses were generated by transfection of a three-plasmid system: pCIG3-N for expression N-MLV gag/pol (Addgene #132941, a gift from Jeremy Luban) [50] ...
-
bioRxiv - Immunology 2021Quote: ... or 2C-T (AmpR, N-terminal His6-MBP fusion; Addgene #29706). Plasmids were transformed into E ...
-
bioRxiv - Neuroscience 2020Quote: ... full name AAV-EF1a-DIO-trkB.DN-TM570-mCherry (Addgene, n°121502), was constructed by PCR amplification of rat truncated trkB.T1 with the sequence downstream of the transmembrane domain replaced by the sequence of three alanine residues followed by a stop codon (from the plasmid pLTM570 ...
-
bioRxiv - Microbiology 2021Quote: ... a pHAGE N-mNeonGreen IRES puro was also generated (Addgene #170467).
-
bioRxiv - Cell Biology 2022Quote: ... N-terminal IBAR genes were cloned into Cry2PHR-mCherry (Addgene #26866) using NheI and XhoI restriction sites (Kennedy et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... pZac2.1-hSynapsin1::NAPA-N SV40 (gift from Baljit Khakh, Addgene #92282) (titer ...
-
bioRxiv - Neuroscience 2021Quote: ... mEos3.2-Homer1-N-18 was a gift from Michael Davidson (Addgene plasmid # 57461 ...
-
bioRxiv - Biophysics 2022Quote: ... pCMV-mApple-MyosinIIA-N-18 (Addgene #54930, gift from Michael Davidson), and pEGFP internal GFP Ezrin (gift from Florence Niedergang).
-
bioRxiv - Cell Biology 2020Quote: ... and mCherry-Cx43-N-7 were gifts from Michael Davidson (Addgene plasmids # 55112 ...
-
bioRxiv - Physiology 2020Quote: ... the mouse N-Shh sequence was then cloned in pRRLsin.MND.MCS.WPRE (Addgene) that had been previously digested by NheI and PmlI ...
-
bioRxiv - Biophysics 2022Quote: ... pCMV-mCherry-FilaminA-N-9 (Addgene #55047, gift from Michael Davidson), pCMV-mEmerald-Alpha-Actinin-19 (Addgene #53989 ...
-
bioRxiv - Cell Biology 2022Quote: ... construct was cloned into a pLVpuro-CMV-N-EGFP (Addgene, #122848) lentivirus plasmid using the gateway system (ATTB sites were added at the Paxillin-peGFP plasmid using the primers ...
-
bioRxiv - Molecular Biology 2023Quote: N-terminal histidine tagged wild-type VCP was obtained from Addgene (plasmid #12373 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pLVpuro-CMV-N-EGFP was a gift from Robin Ketteler (Addgene plasmid # 122848 ...
-
bioRxiv - Biochemistry 2023Quote: ... or N-terminal His10-MBP Tag (2CT-10; Addgene Plasmid #37237) were chosen as the MBP tag has been shown to increase the solubility of select proteins [9] ...
-
bioRxiv - Cell Biology 2023Quote: ... Ad-mApple-TOMM20 derived from mApple-TOMM20-N-10 (Addgene #54955), Ad-EGFP-BNIP3 ...
-
bioRxiv - Cancer Biology 2023Quote: ... we initially electroporated with a pCAGGS-mCherry plasmid (Addgene n°41583) in CNC or TNC cells at 7ss and 14ss ...
-
bioRxiv - Immunology 2023Quote: pcDNA3-N-Flag-NLRP3 plasmid encoding mouse NLRP3 (Addgene plasmid # 75127) was a gift from Bruce Beutler61 ...
-
bioRxiv - Biochemistry 2023Quote: ... pDEST-CMV-N-EGFP was a gift from Robin Ketteler (Addgene plasmid # 122842 ...
-
bioRxiv - Cancer Biology 2020Quote: Plasmid 821 pGEX2T PTEN 1-274 (N-PTEN) was a gift from William Sellers (Addgene plasmid # 10741) (Ramaswamy et al. ...
-
bioRxiv - Microbiology 2023Quote: ... the puromycin N-acetyltransferase (PAC) gene was amplified from pLenti CMV Puro DEST (w118-1) (Addgene #17452) by PCR ...
-
bioRxiv - Molecular Biology 2019Quote: ... and RPA 2 and 3 were cloned into 11A vectors (Addgene: 48294), followed by assembly of all RPA subunits into one vector by successive ligation independent cloning reactions ...
-
bioRxiv - Neuroscience 2020Quote: 8 weeks old Mrap2fl/fl Mc4regfp females (n=4) were injected unilaterally with pAAV-Ef1a-mCherry-IRES-CRE (Addgene, catalog #55632-AAV8).
-
bioRxiv - Cell Biology 2022Quote: ... gBlock 1 encoding N-terminus Calponin domains (CH-CH) of giant Nesprin 1 was cloned into Spectrin-cpstFRET (plasmid#61109, Addgene) cut with AgeI and ScaI renstriction enzymes (New England Biosciences) ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:2 dilution) or AAV5-pCAG-FLEX-EGFP-WPRE (1.1 x 1013 gc/ml, Addgene; 1:2 dilution) was injected in VTA (from bregma ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 P.1 (Addgene, #170450), SARS-CoV-1 (Addgene ...
-
bioRxiv - Cell Biology 2019Quote: ... EGFP-vinculin head (residue 1-258) and the N-terminal fusion of vinculin-T12 were obtained from Addgene (#46270 ...
-
bioRxiv - Microbiology 2024Quote: ... N/Tert-1 Cas9 knockout cells were generated by transduction with a spCas9 lentiviral expression vector (Addgene # 52962) and selecting with blasticidin ...
-
bioRxiv - Genomics 2022Quote: pNLZ10 (Pfib-1::NLS::dCas9::24xGCN4::NLS::tbb-2 3’UTR) construct contains pCFJ150 vector backbone (Addgene plasmid # 19329). SV40 NLS::dCas9::egl-13 NLS: ...
-
bioRxiv - Cancer Biology 2024Quote: ... GGTGAGGTGGAAATGAGCCA; HK1-3: GGAGGGCAGCATCTTAACCA) and HK2 (HK2-1: GATGCGCCACATCGACATGG; HK2-2: TAAGCGGTTCCGCAAGGAGA) was cloned into lentiCRISPR v2 construct (RRID:Addgene_52961) using a protocol available online (Zhang_lab_LentiCRISPR_library_protocol.pdf) ...
-
bioRxiv - Developmental Biology 2021Quote: ... N-terminal KRAB-dCas9 (a gift from Bruce Conklin, Addgene plasmid # 73498) fused with a destabilising domain ...
-
Rhes protein transits from neuron to neuron and facilitates mutant huntingtin spreading in the brainbioRxiv - Neuroscience 2021Quote: ... pEGFP-N-Drd1 plasmid was a gift from Kirk Mykytyn (Addgene, 104358), GFP-DRD2 plasmid was a gift from Jean-Michel Arrang (Addgene ...
-
bioRxiv - Biochemistry 2019Quote: ... coli Destination vector pDest-566 (N-terminal His6-MBP tag, Addgene #11517). Final baculovirus expression clones were transformed into DH10Bac cells (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2019Quote: ... mCherry-SiT-N-15 plasmid was a gift from Michael Davidson (Addgene plasmid # 55133 ...
-
bioRxiv - Biochemistry 2021Quote: ... pLPC-puro-N-Flag was a gift from Titia de Lange (Addgene plasmid # 12521 ...
-
bioRxiv - Cell Biology 2021Quote: ... The resulting PCR product was inserted into pLVpuro-CMV-N-EGFP (Addgene plasmid # 122848 ...
-
bioRxiv - Cell Biology 2019Quote: ... and mEmerald-IFT88-N-18 was a gift from Michael Davidson (Addgene plasmid # 54125 ...
-
bioRxiv - Cell Biology 2020Quote: ... mApple-SSTR3-N-17 was a gift from Michael Davidson (Addgene # 54949). SSTR3 was shuttled into CSII-EF lentiviral vector into XhoI/XbaI site by Gibson cloning using the primers aacacgctaccggtctcgagaattcatggccactgttacctatcctt and tgctcaccatcagatggctcagtgtgctgg for SSTR3 ...
-
bioRxiv - Neuroscience 2019Quote: ... an eGFP-only reporter without DREADDs (n=7; Addgene: AAV2-hSyn-eGFP), was employed in a group of control rats [65–67].
-
bioRxiv - Cancer Biology 2021Quote: ... and pcDNA3-RLUC-POLIRES-FLUC (a gift from N. Sonenberg; Addgene #45642) (Poulin et al. ...