Labshake search
Citations for Addgene :
101 - 150 of 493 citations for 6 Bromo benzo c isothiazole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... 6-week-old Vglut2-Cre mice were injected with pAAV-EF1a-DIO-tdTomato-WPRE virus (RRID:Addgene_133786 ...
-
bioRxiv - Cell Biology 2022Quote: ... human ubiquitin C-driven CymR Cuo repressor purchased from Addgene (#119907) into pPig-Hygro transposase backbone from Max Wilson ...
-
Rab35 Governs Apicobasal Polarity Through Regulation of Actin Dynamics During Sprouting AngiogenesisbioRxiv - Developmental Biology 2022Quote: ... mEmerald-ARP2-C-14 (gift from Michael Davidson, Addgene plasmid # 53992); MICAL-L1 (Origene ...
-
Rab35 Governs Apicobasal Polarity Through Regulation of Actin Dynamics During Sprouting AngiogenesisbioRxiv - Developmental Biology 2022Quote: ... mEmerald-Fascin-C-10 (gift from Michael Davidson, Addgene plasmid # 54094); pARF6(Q67L)-CFP (gift from Joel Swanson ...
-
bioRxiv - Molecular Biology 2019Quote: ... FKH2 was entirely replaced with URA3 (C. albicans) using pAG61 (Addgene), and the resulting strain was transformed with fkh2-dsm DNA from p405-fkh2-dsm (Ostrow et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... mCherry-LaminA-C-18 was a gift from Michael Davidson (Addgene plasmid # 55068 ...
-
bioRxiv - Microbiology 2022Quote: ... C-terminal Flag-tagged pCAGGS-SARS2-S-D614 (Addgene plasmid #156420) and pCAGGS-SARS2-S-G614 (Addgene plasmid #156421 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and a C’-terminal yellow fluorescent protein (YFP; pICSL50005, Addgene #117536), and AtuOCS terminator ...
-
bioRxiv - Immunology 2020Quote: mApple-Dectin1A-C-10 was a gift from Michael Davidson (Addgene plasmid # 54883 ...
-
bioRxiv - Cell Biology 2022Quote: ... mEmerald-MAP4-C-1069 was a gift from Michael Davidson (Addgene plasmid # 54152 ...
-
bioRxiv - Microbiology 2022Quote: ... mEmerald-MAP4-C-10 (a gift from Dr. Michael Davidson (Addgene plasmid # 54152 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and C-FLAG-D20 or EGFP (pEGFP-N1-FLAG, Addgene 60360) chimeras were also subcloned into the XhoI and MfeI linearized attb-BSDr vector using the NEBuilder HiFi Assembly Kit ...
-
bioRxiv - Plant Biology 2023Quote: ... a C-terminal 3×FLAG® epitope tag (pICSL50007; Addgene #50308), and 3′ UTR and terminator sequences from Agrobacterium tumefaciens nopaline synthase (AtuNOST ...
-
bioRxiv - Cell Biology 2023Quote: ... mRuby2-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid # 55889 ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCDH-Flag-c-MYC was a gift from Hening Lin (Addgene plasmid # 102626 ...
-
bioRxiv - Cell Biology 2023Quote: ... and inserted into the pScarlessHD-C-3xVHH05-DsRed (Addgene, Plasmid #171580) (63 ...
-
bioRxiv - Plant Biology 2023Quote: ... The B- and C-modules with mTurquoise2 (amplified from an AddGene-derived template (Goedhart et al. ...
-
bioRxiv - Immunology 2023Quote: Human CD86 C-terminally tagged with enhanced GFP (pCD86-EGFP, Addgene) was sub-cloned into a modified version of the MSCV2.2 retroviral plasmid in which the IRES-GFP cassette was removed ...
-
bioRxiv - Cell Biology 2024Quote: ... were cloned into the plasmid TVBB C-term-mScarlet (Addgene 169219) with the purpose of knocking in mScarlet in frame with D882 ...
-
bioRxiv - Molecular Biology 2024Quote: ... HAMECs were transfected with mCherry-CD36-C-10 (Addgene: Plasmid #55011), 8µg of plasmid was used per 1 million cells using nucleofection.
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were transfected with mCherry-CD36-C-10 (Addgene: Plasmid #55011), 5µg per 10cm dish or 0.5µg per well of a 6-well dish ...
-
bioRxiv - Cell Biology 2022Quote: ... Viral transductions were done on day 6 with 5 μL of AAV1-CaMKII-GLuc-ASARTDL (Addgene 149503) or AAV1-CaMKII-GLuc-Untagged (Addgene 149502 ...
-
bioRxiv - Neuroscience 2020Quote: ... This product was subcloned into pBPLexa:P65UW (Addgene plasmid # 26231, 63 or pBPGal80uw-6 (Addgene plasmid # 26236, 63), which were gifts from Gerry Rubin ...
-
bioRxiv - Neuroscience 2020Quote: ... In one C57BL/6 animal each we used AAV5-Syn-GCaMP6s or AAVrg-Syn-jGCaMP7f (Addgene, USA) with similar results to those obtained with GCaMP6f (Supplementary Fig ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
bioRxiv - Cancer Biology 2023Quote: ... RB1 and TP53 sgRNA sequences highlighted in Supplementary Table 6 were cloned in a LentiCRISPRv2 (Addgene # 52961) backbone (47) ...
-
bioRxiv - Microbiology 2024Quote: ... Guide RNAs targeting exon 6 of Akr1c13 were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene #42230). A T7-sgRNA PCR product was amplified and in vitro transcribed as previously described (65 ...
-
bioRxiv - Cell Biology 2020Quote: Addgene plasmids used were: pCMV-lyso-pHluorin (RRID:Addgene_70113, gift from C. Rosenmund28), pLAMP1-mCherry (RRID:Addgene_45147 ...
-
bioRxiv - Biophysics 2019Quote: ... pGFP-Cytochrome C was a gift from Douglas Green (Addgene plasmid # 41181). GPI-mNeonGreen was created by replacing GFP with mNeonGreen ...
-
bioRxiv - Biochemistry 2022Quote: ... mEmerald-JUP-C-14 (Addgene plasmid # 54132; http://n2t.net/addgene:54132; RRID:Addgene_54132) and mEmerald-Beta-Catenin-20 (Addgene plasmid # 54017 ...
-
bioRxiv - Neuroscience 2020Quote: ... (2) AAV1-hSYN-β-Arrestin2-TEV-C-P2A-TdTomato (Addgene Cat #: 89873), (3 ...
-
bioRxiv - Cell Biology 2022Quote: mEmerald-Zyxin-C-14 construct (Addgene # 54318; a gift from Michael Davidson) was cloned into the lentiviral vector pLL5.0 (Vitriol et al. ...
-
bioRxiv - Immunology 2022Quote: ... pVitro-hygro-N-myc-hVps34/Vps15-C-V5-his-plasmid (Addgene #24055), pEGFP-Atg14L (Addgene #21635 ...
-
bioRxiv - Plant Biology 2022Quote: ... StTGA2.3 was fused with a C-terminal mTagBFP2 (from Addgene plasmid # 102638)74 blue fluorescent protein (BFP ...
-
bioRxiv - Systems Biology 2022Quote: ... the PINK1 insert was derived from pCMVTNT-PINK1-C-Myc (Addgene, #13314) and the mNeonGreen insert was obtained as cDNA (Allele Biotech ...
-
bioRxiv - Cell Biology 2023Quote: ... mPA-GFP-MyosinIIA-C-18 was a gift from Michael Davidson (Addgene plasmid # 57149 ...
-
bioRxiv - Neuroscience 2023Quote: ... C-terminally GFP-tagged Mannosidase cDNA was obtained from Addgene (plasmid #160905) and used without additional subcloning ...
-
bioRxiv - Cell Biology 2023Quote: ... hNHE1-HA (3X on c-terminal) (pYN4+, #78715) was originally from Addgene with D720G mutation ...
-
bioRxiv - Neuroscience 2024Quote: ... c-Myc-5-HT2A was a gift from Javier Gonzalez-Maeso (Addgene plasmid # 67944 ...
-
bioRxiv - Neuroscience 2021Quote: ... 6-7E6 cells were resuspended in nucleofection solution and mixed with 3ug of pCAG-EGFP plasmid (Addgene, 89684) and 600nM of siRNA ...
-
bioRxiv - Microbiology 2019Quote: ... C57BL/6 MEFs were transfected with GFP- or HA-epitope tagged ubiquitin plasmids (Addgene #11928 and #18712, respectively) 24 hours before infection ...
-
bioRxiv - Biochemistry 2020Quote: The original coding sequence for H2B:GFP was taken from pCS2-H2B:GFP plasmid (Addgene, Plasmid #53744, Supplementary Fig. 6), manually codon-optimized to minimize the occurrence of poly-Cn stretches (n<3) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The two sgRNAs targeting Dazl exon 6 were cloned into the pSpCas9(BB)-2A-GFP backbone (Addgene #48138). The knock-in led to the generation of a reporter cell line named Dazl-mScarlet-HygromycinR (DASH) ...
-
bioRxiv - Cell Biology 2020Quote: ... and ESRG (6 μg each) along with 3 μg of pMD2.G (gift from Dr. D. Trono; RRID:Addgene_12259) was transfected into PLAT-GP packaging cells ...
-
bioRxiv - Molecular Biology 2022Quote: ... Two million iPSCs were electroporated with 6 μg of CAG- Cas9-T2A-EGFP-ires-Puro (deposited in Addgene, plasmid no ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV5-CMV-EGFP (Suppl. Figs. 1A, 6 and 7D; Salk Vector Core; 2.08 x 1012; Addgene plasmid #32395); AAV9-FLEX-rev-ChR2-tdTomato (Suppl ...
-
bioRxiv - Neuroscience 2020Quote: The DNA fragment of H2B-mEos4b-6 (a gift from Michael Davidson (Addgene plasmid # 57508; http://n2t.net/addgene:57508; RRID:Addgene_57508)) and TRE (pTRE-tight vector (Clontech #631059) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Lee and Luo 1999)- with the codon optimized GAL80 sequence from pBPGAL80Uw-6 - a gift from Gerald Rubin (Addgene plasmid #26236, http://n2t.net/addgene:26236; RRID:Addgene_26236) (Pfeiffer et al ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were plated in 6-well plate and co-transfected with SBE4-Luc plasmid (1 μg, Addgene,16495) and pDEST26-Renilla plasmid (0.1 μg ...
-
bioRxiv - Developmental Biology 2023Quote: ... EGFP-Tubulin-6 was a gift from Michael Davidson (Addgene plasmid # 56450; http://n2t.net/addgene:56450; RRID: Addgene_56450). mTagBFP-Lysosomes-20 was a gift from Michael Davidson (Addgene plasmid # 55263 ...