Labshake search
Citations for Addgene :
101 - 150 of 2679 citations for 2 Bromo 1 5 bromofuran 2 yl ethanone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... PCR products or Plasmids were micro-injected into CB4088 [him-5(e1490)] hermaphrodites with myo-2::mCherry from plasmid pCFJ90 (Addgene) as co-injection marker ...
-
bioRxiv - Immunology 2024Quote: ... lentiviral particles were produced by co-transfection of 2 × 106 293T cells with 5 μg of LentiCRISPRv2GFP plasmid (Addgene # 82416) expressing the gRNA targeting the gene of interest or non-targeting control (CTRL ...
-
bioRxiv - Cell Biology 2020Quote: ... pPD118.33 (Pmyo-2∷GFP) (Addgene plasmid #1596) at 5 ng/μl and pBSKS (Stratagene ...
-
bioRxiv - Microbiology 2022Quote: ... pDONR223 SARS-CoV-2 NSP2 (Addgene, 141256) and expression clones with N-terminal fusion tags were produced simply by Gateway cloning (Gateway™ LR Clonase™ II Enzyme mix ...
-
bioRxiv - Microbiology 2022Quote: ... pDONR207 SARS-CoV-2 NSP1 (Addgene, 141255), pDONR223 SARS-CoV-2 NSP2 (Addgene ...
-
bioRxiv - Genomics 2020Quote: ... pCFJ90 - Pmyo-2∷mCherry∷unc-54utr (Addgene plasmid # 19327 ...
-
bioRxiv - Neuroscience 2020Quote: [2] GAL4d from pBPGAL4.1Uw (Addgene plasmid #26226)(Primers:ADdomain,forward,5’-caggcggccgccataTGCATGGATCCGCCAACTTC AACCAGAGTGG-3’ ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.1.7 (Addgene, #170451), SARS-CoV-2 B.1.351 (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.351 (Addgene, #170449), SARS-CoV-2 P.1 (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.167.2 (Addgene, #172320), SARS-CoV-2 B.1.1.7 (Addgene ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and pBMTBX-2 (Addgene plasmid No. 26073) were gifts from Dr ...
-
bioRxiv - Cell Biology 2023Quote: ... and pcDNA3.1-2xFLAG-SREBP-2 (#26807, Addgene). Amplified N-SREBP1a (Ad5-N-SREBP1a) ...
-
bioRxiv - Molecular Biology 2022Quote: ... For overexpressing ACE2 (Addgene, Appendix Table 2) in HPLFs ...
-
bioRxiv - Microbiology 2023Quote: ... pDONR223 SARS-CoV-2 spike (Addgene #149329), B.1.1.7 SARS-CoV-2 spike (Sino Biological ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 2 µg pMD2.G (#12259, Addgene) plasmids by using lipofectamine 2000 (Life Technologies) ...
-
bioRxiv - Microbiology 2023Quote: ... pDONR223 SARS-CoV-2 NSP6 (Addgene #141260), and pDONR223 SARS-CoV-2 spike (Addgene #149329 ...
-
bioRxiv - Microbiology 2023Quote: ... pDONR207 SARS-CoV-2 nsp3 (Addgene # 141257), pDONR223 SARS-CoV-2 NSP6 (Addgene #141260) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... NKX6.1 in pX330S-2 (Plasmid #58778; Addgene), MAFA in pX330S-3 (Plasmid #58779 ...
-
bioRxiv - Genetics 2024Quote: ... and β-arrestin 2-mYFP (Addgene #36917). FUZ-mCherry was generated by sub-cloning with XhoI/BamHI into mCherry2-N1 backbone vector (Addgene #54517) ...
-
bioRxiv - Cell Biology 2023Quote: ... pHAGE-FKBP-GFP-OPTN (2-119) (RRID:Addgene_208867), pHAGE-mt-mKeima-P2A-FRB-Fis1 (RRID:Addgene_135295).
-
bioRxiv - Immunology 2022Quote: ... 2 µg pMDLg/pRRE (Addgene plasmid #12251), 4.64 µg pRSV-Rev (Addgene plasmid #12253) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and psPAX2 (2 µg; Addgene, Cat# 12260) were co-transfected with lentiviral expression construct (3 µg ...
-
bioRxiv - Genomics 2023Quote: ... and pMDG.2 (envelope vector; Addgene #12259) with the TKOv3 lentiCRISPR plasmid library [59] ...
-
bioRxiv - Neuroscience 2023Quote: ... ipo13b sgRNA2 into pU6a:sgRNA#2 (Addgene #64246), and ipo13b sgRNA3 into pU6b:sgRNA#3 (Addgene #64247) ...
-
bioRxiv - Molecular Biology 2023Quote: ... together with psPAX-2 (Addgene plasmid #12260) and pMD2.G (Addgene plasmid #12259) ...
-
bioRxiv - Microbiology 2024Quote: ... we used pcDNA3-GFP-IMP2-2 (Addgene plasmid # 42175 ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 µg of psPAX.2 (Addgene, #12260), and 3 µg of sgRNA plasmid into HEK293T cells seeded in 6-well plates at 70% confluence using jetPRIME transfection reagent according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... 2.) piRES-puro vector (Addgene Cat# 25728) with EcoRI and NotI sites for site-directed mutagenesis experiments.
-
bioRxiv - Genetics 2024Quote: ... pMXs.hSox2 (SRY-Box Transcription Factor 2, RRID:Addgene_17218), pMXs.hKlf4 (Kruppel Like Factor 4RRID:Addgene_17219) ...
-
bioRxiv - Biochemistry 2024Quote: ... two all-in-one CRISPR-Cas9 vectors were generated from pX330A-1×2 (58766, Addgene) and pX330S-2-PITCh (63670 ...
-
bioRxiv - Biochemistry 2023Quote: ... coli BL21 (DE3) cells using the plasmid pRSFDuet-1/CylLL/CylM-2 (Addgene ID #208759), following the method previously reported.9 For the preparation of lanthionine standard ...
-
bioRxiv - Microbiology 2022Quote: ... 500 ml LB culture of pCDFDuet-1-6×His-SARS-CoV-2-NSP7/NSP8 (Addgene)-transformed E.coli BL21 DE3 strain was induced by isopropyl β-d-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Cell Biology 2024Quote: ... and 2 (sgRNA-GALC2: 5’ TACGTGCTCGACGACTCCGA 3’) were subcloned individually into pX459 v2.0 (gift from Dr. Feng Zhang, Addgene plasmid #6298832). GALC targeting sequences were further tested by the Off-Spotter software to minimize potential off target effect ...
-
bioRxiv - Genomics 2022Quote: ... Each 15-cm2 plate was transfected with a total of 21 μg of plasmid DNA (1:2:1 ratio psPAX2-D64V:pLenti-STARR:pLAI-Env) [psPAX-D64V (Addgene #63586), and pLAI-HIV (Addgene #133996)] ...
-
bioRxiv - Biochemistry 2024Quote: ... pLKO.1 puro CXCR4 siRNA-1 and siRNA-2 were gifts from Bob Weinberg (Addgene plasmids #12271 and #12272). plKO.1 scramble shRNA was a gift from David Sabatini (Addgene plasmid #1864) ...
-
bioRxiv - Immunology 2022Quote: ... The Vκ1-33/CBE replacement of Vκ3-2 was mediated by homologous recombination using a PGKneolox2DTA.2 (Addgene #13449) construct and two guide RNAs that target the mouse Vκ3-2 segment ...
-
bioRxiv - Cancer Biology 2023Quote: ... the murine shRNA hairpins pLKO.1-shCdkn2a #1 (TRCN0000077816) and #2 (TRCN0000362595) and the human and murine pLKO.1-shGFP control (Addgene, cat#30323) vectors were packaged using the ViraPower Kit (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 µL of the adeno-associated viral vector rAAV9/1.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, #20298-AAV9) was dyed with 0.3 µL fast green (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... and AAV.Syn.NES-jRGECO1a.WPRE.SV40 (Serotype 2/9; titer ≥ 1×1013 vg/mL) viruses were purchased from Addgene.
-
bioRxiv - Immunology 2021Quote: ... Guide 1 (TGTTGGGGAACATATGACAC) and Guide 2 (AAGGAAAAATTCAAACAAGG) sequences were cloned into lentiGuide-puro plasmid (Addgene, #52963), transformed in Stbl3 bacteria (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 µL of the adeno-associated viral vector rAAV9/1.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, #20298-AAV9) was dyed with 0.3 µL fast green (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: Heterozygous ChAT-Cre mice were bilaterally injected with 1.0 µL of pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (diluted 1:2 in dPBS; Addgene: 100845-AAV5) in basal forebrain (AP ...
-
bioRxiv - Genetics 2023Quote: pHarvester was generated using pCFD5-gRNA#1&2 and pnos-Cas9-nos plasmids (Addgene no: 62208). Briefly ...
-
bioRxiv - Microbiology 2022Quote: UAS-SARS-CoV-2-ORF3a transgenic flies were generated by PCR-mediated subcloning of the SARS-CoV-2-ORF3a coding sequence (pDONR207-SARS-CoV-2 ORF3a, #141271, Addgene) into pUASt-Attb (EcoRI/XbaI) ...
-
bioRxiv - Immunology 2023Quote: ... pDONR207 SARS-CoV-2 M and pDONR207 SARS-CoV-2 ORF3a (all plasmids were gifts from Fritz Roth via Addgene, # 141273 ...
-
bioRxiv - Microbiology 2022Quote: pCMV-GFP-SARS-CoV-ORF3a was generated by recombining the SARS-CoV-2-ORF3a coding sequence (pDONR207 SARS-CoV-2 ORF3aA, #141271, Addgene) into pDEST-CMV-N-EGFP (#122842 ...
-
bioRxiv - Microbiology 2024Quote: The following open reading frames were cloned into an expression vector under the control of the phosphoglycerate kinase promoter: IKK-2 and its mutant IKK-2 K44M (Addgene plasmids #11103 and #11104 ...
-
bioRxiv - Biophysics 2024Quote: ... equal amounts of both pLVX-EF1alpha-SARS-CoV-2-nsp5-2×Strep-IRES-Puro (Mpro) (a gift from Nevan Krogan; Addgene #141370 ...
-
bioRxiv - Biophysics 2024Quote: HEK293T cells were co-transfected with mSca-containing DuProSense biosensor plasmid DNA and pLVX-EF1alpha-SARS-CoV-2-nsp5-2×Strep-IRES-Puro (Mpro) (a gift from Nevan Krogan; Addgene #141370 ...
-
bioRxiv - Biophysics 2024Quote: ... along with either pLVX-EF1alpha-SARS-CoV-2-nsp5-2×Strep-IRES-Puro (Mpro) (a gift from Nevan Krogan; Addgene #141370 ...