Labshake search
Citations for Addgene :
1401 - 1450 of 1541 citations for Recombinant Human PRMT5 Flag & His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: The chimeric antigen receptor against human CD276 (Du et al., 2019) and CD19 (Maude et al., 2018)together with the Thy1.1 surface antigen (Addgene 154194)(Umkehrer et al. ...
-
bioRxiv - Microbiology 2023Quote: Human and cat ACE2 expressing lentiviral plasmids (pscALPS-hACE2 and pscALPS-cACE2) were obtained from Addgene (158081 and 158082, respectively). Each gene was tagged with a c-terminal Myc-tag epitope to facilitate detection ...
-
bioRxiv - Cancer Biology 2023Quote: ... we designed single guide RNAs to target the exon 1 of the human Per2 gene and subcloned it into the PX459 vector (Addgene) to obtain the PX459-Per2 plasmid ...
-
bioRxiv - Cancer Biology 2023Quote: Human AKT1_D274A was generated by overlapping PCR mutagenesis using wild-type AKT1 (a gift from Thomas Leonard, Addgene plasmid 8656133) and cloned into a pAceBac1 vector with N-terminal His10-StrepII-(tev ...
-
bioRxiv - Cell Biology 2023Quote: A plasmid for expression of full-length human KIF1C (pKIF1C-GFP) was a gift from Anne Straube (Addgene plasmid #130977107). All truncated versions of KIF1C (see Resource Table) ...
-
bioRxiv - Cancer Biology 2024Quote: Murine KSR1 (resistant to degradation by sgRNA sequences targeting human KSR1) was cloned into MSCV-IRES-KSR1-RFP (Addgene #33337) and PEI transfected into HEK293T cells along with pUMVC retroviral packaging construct (Addgene #8449 ...
-
bioRxiv - Cancer Biology 2024Quote: Truncated CPSF6 containing amino acids 1-358 (CPSF6-358) from human isoform 1 was cloned into the pCW57.1 backbone (Addgene 71782). A hemagglutinin (HA ...
-
bioRxiv - Microbiology 2024Quote: ... annealing to exon 4 of the ORF of the human BST2 gene was designed and cloned into lentiCRISPR v2 (Addgene). Next ...
-
bioRxiv - Cell Biology 2020Quote: Plasmid YFP-SRI was generated by sub-cloning human sorcin cDNA taken from pAd-hSRI (22) into KpnI-ApaI sites of mVenusC1 (Addgene #27794).
-
bioRxiv - Molecular Biology 2021Quote: ... similar to how we previously generated the human cell expression constructs for AcrIIA4 and AcrIIA5 (Addgene IDs 133801 and 133802, respectively) (see Supplementary Sequences) ...
-
bioRxiv - Cell Biology 2022Quote: ... and Δ50 were PCR amplified from human templates using forward (fwd) primer 1593 and reverse (rev) primer 1651 and inserted into mycBioID2 pBabe puro (Addgene #80901) cut EcoRI to PmeI ...
-
bioRxiv - Genetics 2019Quote: sgRNAs targeting human ADCK4 (sgRNA1: GCTGCACAATCCGCTCGGCAT, sgRNA2: GTAAGGTCTGCACAATCCGCT, and sgRNA3: GACCTTATGTACAGTTCGAG,) were cloned into BsmBI-digested lentiCRISPR v2 (Addgene plasmid #52961). ADCK4 cDNA was cloned into the p3xFLAG CMV26 (C-terminal ...
-
bioRxiv - Neuroscience 2020Quote: ... was cloned into a rAAV vector under the human synapsin promoter using the plasmid pAAV-hSyn-EGFP (gift from Bryan Roth; Addgene, #50465) as backbone and removing EGFP ...
-
bioRxiv - Neuroscience 2020Quote: UAS-SMARCA1 construct: Flies carrying UAS-SMARCA1WT were generated using human SMARCA1 cloned into the pFastBac Dual vector (Addgene plasmid #102243). Gateway cloning (Invitrogen ...
-
bioRxiv - Bioengineering 2020Quote: A pair of guide RNA targeting human EGFR was cloned into pSpCas9(BB)-2A-GFP (px458) plasmid vector (Addgene plasmid #48137) (Addgene ...
-
bioRxiv - Biophysics 2021Quote: ... Fractions containing the target proteins were dialyzed against PBS (pH 7.4) and the His6-SUMO-tag was removed by enzymatic cleavage using human SENP1 protease at 4°C overnight (Addgene #16356) (51) ...
-
bioRxiv - Cell Biology 2021Quote: ... The human MISP and EGFP-MISP sequences were subcloned into modified pFastBac-6xHis-MBP plasmid LIC expression vector (Addgene; plasmid #30116). All constructs were confirmed by sequencing.
-
bioRxiv - Microbiology 2020Quote: ... Vesicular stomatitis virus G protein (VSV-G) pseudotyped lentiviruses expressing human ACE2 were produced by transient co-transfection of pMD2G (Addgene #12259) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Neuroscience 2020Quote: ... with a pEGFP-C1 mammalian vector containing full length human A53T variant αSyn with a fusion EGFP tag (Addgene, Plasmid #40823), following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... uracil glycosylase inhibitor (UGI) and 3’UTR of human ATP5B was amplified from the published DdCBE construct (Addgene plasmid no. 157843). The PCR product was digested with the restriction enzymes XbaI and EcoRI ...
-
bioRxiv - Biochemistry 2020Quote: Human ATAD2/B cDNA (UniProt codes Q9ULIO and Q6PL18) was a gift from Nicole Burgess-Brown (Addgene plasmid # 38916 and 39046)7 ...
-
bioRxiv - Microbiology 2020Quote: ... A CRISPR/Cas9 lentiviral vector against human-β2 microglobulin was constructed by cloning an expression cassette for both Cas9 and guide RNA (gRNA) of PX458 (Addgene #48138) into the FG12 vector ...
-
bioRxiv - Cell Biology 2021Quote: ... The coding sequence for human Dia1 was purchased from GeneScript and cloned in eBFP2-N1 backbone vector (gift from Michael Davidson, Addgene #54595) using XhoI/Kpn1 double digestion ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293T cells seeded to 150mm dishes were transfected with 21 μg of the human gRNA pooled library in lentiGuide-Puro (Addgene #1000000049), 15.75 μg of pSPAX2 and 5.25 μg of pVSV-G plasmids ...
-
bioRxiv - Biochemistry 2022Quote: ... Full-length human KRAS4B G12C was ectopically expressed from the retroviral expression vector pBABE containing an N-terminal HA-tag (Addgene #58901). Viral particles were generated by transient transfection of each expression vector into HEK 293T cells using Fugene6 (Promega ...
-
bioRxiv - Cancer Biology 2022Quote: ... These cells were then infected with an inducible Tet-ON lentivirus carrying the human PLK1 cDNA (pLenti CMVtight Hygro DEST from Addgene #26433) and selected with hygromycin (350 µg/ml) ...
-
bioRxiv - Cancer Biology 2022Quote: ... carrying the human CRISPR KO pooled library Brunello in a lentiGuide-Puro backbone (gift from David Root and John Doench; Addgene #73178) to a final volume of 2 mL with 4 µg/mL polybrene ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tetracycline-inducible TET-shRB1 and constitutive shRB1 constructs were created by integrating validated siRNA sequences GAAAGGACATGTGAACTTA (63) and GAACGATTATCCATTCAAA (64) targeting human RB1 (shRB1) into TET-pLKO.1-Puro vector (Addgene #21915) and pLKO.1-Puro vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... plasmids were created by integrating validated siRNA sequences CCTGTCAGGAAACTGTATGAT (62) and AATGGCCATCAGAACGGACTT targeting human ESRRG (shESRRG) into pLKO.1-Puro vector (Addgene #8453). Non-specific siRNA sequence AACAGCCACAACGTCTATATC or siRNA sequence CAACAGCCACAACGTCTATAT targeting GFP were used as controls for shRNA ...
-
bioRxiv - Microbiology 2021Quote: ... The oligos of CRISPRa library were synthesized in Synbio Technologies according to the Human Genome-wide CRISPRa-v2 Libraries (Addgene, 83978) (30).
-
bioRxiv - Neuroscience 2020Quote: ... TH-Cre hPSC cells (passage were transduced with a lentiviral construct under control of the human TH-Cre promoter (Addgene, plasmid # …..). The cells were transduced at a multiplicity of infection (MOI ...
-
bioRxiv - Cancer Biology 2022Quote: The human NOTCH 1 intracellular domain (h1NICD) doxycycline-inducible expression plasmid (pLIX-h1NICD) was a gift from Julien Sage (Addgene #91897)11 ...
-
bioRxiv - Cancer Biology 2022Quote: ... we used the Gateway recombination system to introduce the following Myc ORF clone HsCD00039771 in pDONR221from the CCSB Human ORFeome Collection into pHAGE-TRE-DEST-NBioTAP (Addgene #53568) and pHAGE-TRE-DEST-CBioTAP lentiviral vectors (Addgene #53569) ...
-
bioRxiv - Cell Biology 2019Quote: ... Human N-WASP GBD domain was PCR amplified from pCS2-mRFP-GBD (a kind gift from William Bement, Addgene plasmid 26733) with XhoI/AscI flanking restriction sites and cloned into pET-pmKate2 to generate mKate-GBD ...
-
bioRxiv - Immunology 2020Quote: ... Human G3BP1 cDNAs with or without stop codon were amplified by PCR from pN1/G3BP1-iRFP (Okada lab plasmids, Addgene #129339) with the sense primer 5′ -GCCAGATCTATGGTGATGGAGAAGCCTAG-3′ and the antisense primers 5′ -GCCGAATTCGGATCCTTACTGCCGTGGCGC-3′ or 5′ -GCCGAATTCGGATCCCTGCCGTGGCGCAAG-3′ ...
-
bioRxiv - Cell Biology 2021Quote: ... CFP-hRab5C(S35N).dn3 (#1006) encoding Cerulean-labeled dominant negative mutant version of human Rab5C isoform was from Addgene (Cat# 11504). GFP-hEEA1 (#970 ...
-
bioRxiv - Neuroscience 2020Quote: ... the insert consisting of GtACR2-ts-mCerulean3-βHK-Chrimson was cloned into an AAV2-backbone behind a human synapsin (hSyn) promoter (pAAV-hSyn-BiPOLES-mCerulean; Addgene #154944). A soma-targeted ...
-
bioRxiv - Genetics 2021Quote: ... were placed downstream of the human U6 promoter in the pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-Puro backbone (Addgene, #71236). The guide RNA sequences were:
-
bioRxiv - Molecular Biology 2020Quote: ... and RPL22-3xHA (primers JG106/109; human cDNA template) with EcoRI/PstI digested pLV-TetO-hNGN2-P2A-eGFP-T2A-Puro (Addgene #79823) backbone ...
-
bioRxiv - Immunology 2021Quote: ... A549ACE2 cells were generated using lentiviral transduction of a human ACE2 cDNA expressing plasmid (backbone: pLV-EF1a-IRES-Puro (Addgene 85132) as previously described [31] ...
-
bioRxiv - Cell Biology 2021Quote: ... a codon-optimized signal sequence from human ER-resident p23 was inserted into the AgeI site of p-sfGFP-N1 (Addgene #54737). p23ss-sfGFP lacking the stop codon was PCR amplified and flanked with a 3’ NheI site and TA cloned into pCRII-TOPO vector ...
-
bioRxiv - Cell Biology 2021Quote: ... WT and Lig4-/- abl pre-B cells and MCF10A human mammary epithelial cells used in this study all contain pCW-Cas9 (Addgene# 50661), which has a FLAG-tagged Cas9 cDNA under the control of a doxycycline-inducible promoter ...
-
bioRxiv - Cell Biology 2020Quote: ... was made by amplifying TPD54 by PCR from human Tumor protein D54 (IMAGE clone: 3446037) and inserting into pIRES-EGFP-puro (Addgene #45567) via NheI and XhoI ...
-
bioRxiv - Immunology 2022Quote: ... were transduced at 0.3 MOI by both part A and B of the pooled Human GeCKO v2 CRISPR library (Addgene, Cat#1000000049), and subsequently selected using 2 µg/mL puromycin (Calbiochem ...
-
bioRxiv - Cell Biology 2022Quote: ... The pHUJI-LC3B construct was cloned by inserting a codon-optimized gblock encoding pHUJI fused to the N-terminus of human LC3B into the NotI site of pENTR4 (Addgene #17424), and then Gateway-recombined with LR clonase II (Thermo Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... the same procedure was conducted to create and quantify the one-vector format Brunello human CRISPR knockout pooled library (Addgene #73179,59).
-
bioRxiv - Cell Biology 2022Quote: ... REEP1-mEmerald and REEP1-mCherry plasmids were generated by inserting a codon-optimized human REEP1 gblock into mEmerald-N1 (gift from M. Davidson; Addgene #53976) or mCherry-N1 backbones (Clontech) ...
-
bioRxiv - Cancer Biology 2024Quote: The lentiviral vector for Dox-inducible Plexin-B2 overexpression was generated by inserting human PLXNB2 cDNA into a Dox controlled expression vector (pLenti-CMVtight-PLXNB2 iOE; deposited as Addgene #176849) 19 ...
-
bioRxiv - Immunology 2023Quote: DNA comprised of the human HDAC2 gene with flanking BglII and BamHI restriction sites was synthesized and cloned into pmVenus (L68V)-mTurquoise2 (AddGene #60493) such that a fusion protein of mVenus-HDAC2-mTurqoise2 was produced ...
-
Increased dosage of wild-type KRAS protein drives KRAS-mutant lung tumorigenesis and drug resistancebioRxiv - Cancer Biology 2024Quote: ... cells were infected with a lentiviral pool of the Human Brunello CRISPR knockout pooled library (a gift from David Root and John Doench: Addgene #73178) at an MOI of 0.3 and with a coverage of 500 cells per sgRNA ...