Labshake search
Citations for Addgene :
1401 - 1450 of 2724 citations for Mouse Macrophage expressed gene 1 protein MPEG1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2022Quote: ... The nuclear marker H2B-miRFP703 is a fusion of the human H2B clustered histone 11 (H2BC11) with the monomeric near-infrared fluorescent protein miRFP703 (Shcherbakova et al. 2016) (Addgene plasmid #80001). ERK-KTR-mRuby2 ...
-
bioRxiv - Developmental Biology 2022Quote: The pTT3-eGFP vector was constructed by replacing the C-terminal tag encoding region of a bait protein vector (52) (Addgene ID 36150) with eGFP ...
-
bioRxiv - Microbiology 2020Quote: ... This vector expresses an endoplasmic reticulum (ER)-retained truncated Env-EGFP fusion protein. For linearization experiments (Fig. 5) we used plasmid pNL-EGFP/CMV/WPREdU3 (pNL-CMV-GFP) (Addgene, MA, USA). pNL4-3/Luc/Ori and pNL4-3/Luc/Kan were produced by molecular cloning into pNL4-3/Luc ...
-
bioRxiv - Cancer Biology 2020Quote: ... The ECFC-EC and cancer cells were transduced with lentivirus expressing mCherry (LeGO-C2, plasmid # 27339), green fluorescent protein (GFP) (LeGO-V2, plasmid # 27340), or azurite (pLV-Azurite, plasmid # 36086) (Addgene, Cambridge, Massachusetts)39,40 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The ECFC-EC and cancer cells were transduced with lentivirus expressing mCherry (LeGO-C2, plasmid # 27339) or green fluorescent protein (GFP) (LeGO-V2, plasmid # 27340) (Addgene, Cambridge, Massachusetts). To load the microfluidic device ...
-
bioRxiv - Immunology 2020Quote: ... pTwist EF1 Alpha-SARS-Cov-2-S-2xStrep plasmid encoding for the SARS-CoV-2 Spike protein was a gift from Nevan Krogan (Addgene plasmid #141382). pcDNA3-sACE2(WT)-Fc(IgG1 ...
-
bioRxiv - Neuroscience 2022Quote: ... an injection of AAV1 carrying a fused channelrhodopsin2-YFP protein (AAV1-hSyn-ChR2-H134R-eYFP- WPRE, Addgene, viral prep no. 26973-AAV1) was placed into either MEC ...
-
bioRxiv - Cell Biology 2023Quote: ... polyspora Hop1319-529 into UC Berkeley Macrolab vectors to generate N-terminal TEV protease-cleavable His6- or His6-maltose binding protein tags (Addgene #29666, 29706). DNA binding mutants of S ...
-
bioRxiv - Molecular Biology 2023Quote: ... the N-terminal part of FUS protein was used from the plasmid pHR-FUSN-mChr-CRY2WT (a gift from Clifford Brangwynne; Addgene plasmid # 101223). The N-terminal part of SATB1 was cloned into the pCMV-CRY2-mCherry vector using a single BspEI restriction enzyme site from the full-length construct ...
-
bioRxiv - Physiology 2023Quote: ... with the carboxy tail fused to either the N-fragment (VN) or the C-fragment (VC) of the Venus protein (27097, 22011; Addgene, Cambridge, MA), auxiliary subunits CaVα2δ ...
-
bioRxiv - Cell Biology 2023Quote: ... An expression vector for dominant negative KASH (DN-KASH)-mCherry fusion protein was a gift from Daniel Conway (Virginia Commonwealth University, Addgene plasmid #125553) [56] ...
-
bioRxiv - Cell Biology 2022Quote: ... and 0.34 μg of viral entry protein (SARS-CoV-2 Spike, BEI #NR-53742) or pCMV-VSVG (a gift from B. Weinberg, Addgene plasmid #8454) using 8 μl of TransIT-293 (Mirus Bio #MIR 2705 ...
-
bioRxiv - Physiology 2023Quote: ... containing endothelial specific-promoter (CDH5, VE-Cadherin) and green fluorescent protein (GFP) and the plasmid pC4-RhE-FRB-Fis1 (Addgene Cat# 68056) containing human Fis1 gene were purchased from Addgene ...
-
Safe plant Hsp90 adjuvants elicit an effective immune response against SARS-CoV2 derived RBD antigenbioRxiv - Molecular Biology 2023Quote: ... pseudo-type lentiviruses coated with the SARS-CoV-2 S protein harboring the vector pCMV14-3X-Flag-SARS-CoV-2 S (a gift from Zhaohui Qian (Addgene plasmid #145780) were prepared by co-transfecting HEK293T cells with psPAX2 (a gift from Didier Trono (Addgene plasmid # 12260 ...
-
bioRxiv - Cell Biology 2019Quote: ... David Virshup and Xi He (Addgene, Watertown, MA, USA, kit #1000000022) (8) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Volume I was a gift from Richard Murray (Addgene kit #1000000161). pSEVA331Bb was a gift from Tom Ellis (Addgene plasmid # 78269 ...
-
bioRxiv - Cell Biology 2023Quote: ... and the Target Accelerator Pan-Cancer Mutant Collection (Addgene Kit #1000000103)29.
-
bioRxiv - Neuroscience 2022Quote: ... then virus (AAV9-CaMKII-Cre, stock 2.1*1013 particles/nL, 1:1 dilution in PBS, Addgene) was pressure injected (NanoJect III ...
-
bioRxiv - Neuroscience 2021Quote: The lentiviral knockdown constructs were made using pLKO.1-Puro or pLKO.1-GFP plasmids (Addgene) (Zhuang et al ...
-
Microbial signals and lymphotoxin drive TNF-independent death of A20 and ABIN-1 deficient epitheliumbioRxiv - Immunology 2021Quote: ... followed by a GSG linker and mouse IgG2a Fc fusion (amino acid 99-330; UniProtKB/Swiss-Prot P01863) were synthesized and then cloned into pENTR (Addgene Plasmid #17398) using InFusion cloning according to manufacturer’s instructions (Clontech) ...
-
bioRxiv - Physiology 2019Quote: ... Vectors were sourced from OriGene (Rockville, MD) for PISD-expressing plasmid (MR206380), Sigma (St. Louis, MO) for shRNA for mouse PISD (shPSD: TRCN0000115415, and Addgene (Cambridge, MA) for psPAX2 (ID #12260) ...
-
bioRxiv - Biochemistry 2020Quote: ... we amplified the open reading frame from a mouse cDNA library using polymerase chain reaction and inserted it into a pBAD His6 Sumo TEV LIC cloning vector (Addgene Plasmid #37507) that had been engineered to encode an N-terminal Avi tag and C-terminal ybbR tag58 ...
-
bioRxiv - Developmental Biology 2021Quote: ... then the coding sequence for mouse KAT2A was amplified from the vector pCMV-sport2-mGCN5 (gift from Sharon Dent, Addgene plasmid # 23098), and cloned into the backbone vector between SpeI and AvrII sites ...
-
Paracrine signalling between intestinal epithelial and tumour cells induces a regenerative programmebioRxiv - Cancer Biology 2021Quote: ... sgRNA validation sgRNAs cut efficiency was assessed in Mouse Embryonic Fibroblasts (MEFs) infected with a lentivirus expressing the Cas9 enzyme along with blasticidin-resistance (Addgene plasmid #52962). 48 hours upon infection ...
-
bioRxiv - Neuroscience 2022Quote: ... ACGCTTCAATGCTCTCTCGC targeting the second exon of mouse piezo1 as reference (Del Marmol, Touhara et al. 2018) was inserted into MLM3636 vector (Addgene Plasmid #43860). SgRNA inserted MLM3636 and Cas9 expression plasmid pX459 v2.0 (Addgene Plasmid #62988 ...
-
bioRxiv - Physiology 2023Quote: ... The latter consisted of the pLV6 backbone and a mouse per2 promoter with adjacent luciferase sequence contained in the pGL3 basic E2 vector (Addgene plasmid 48747). To ligate the Per2:luciferase reporter with pLV6 backbone we designed a restriction cloning approach shown to be efficient in large plasmids using the QuickChange Lightning Site-Directed Mutagenesis (SDM ...
-
bioRxiv - Biophysics 2023Quote: ... mouse Opa1 sequence was cloned into pR26-CMVconst (Addgene plasmid #127373; http://n2t.net/addgene:127373; RRID: Addgene_127373; kind gift by Lance Miller) to generate pR26-CMV-Opa1 (pAH33) ...
-
bioRxiv - Cell Biology 2024Quote: ... Specific gRNAs against mouse Cyri-b (ex3: CACCGGGTGCAGTCGTGCCACTAGT) were cloned into the sPs-U6-gRNA-Cas9 (BB)-2A-GFP vector (Addgene Plasmid #48138) (Ran et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... and residues 1-133 (Addgene #138422) were PCR amplified from pcDNA4/TO-ORF24-3xFLAG (19 ...
-
bioRxiv - Developmental Biology 2021Quote: pLKO.1-puro plasmids (Addgene #8453) were cloned as previously described (78) ...
-
bioRxiv - Genetics 2019Quote: ... catalytic active lipin 1 (Addgene #32007), pRK5 FLAG wildtype ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLKO.1 Scrambled shRNA (#1864, Addgene), pLKO.1 HIF2α shRNA (#TRCN0000082307 ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLKO.1-TRC (shSCR) (Addgene; 10879) was used as a control ...
-
bioRxiv - Microbiology 2020Quote: ... and AdEasier-1 cells (Addgene #16399) were a gift from Bert Vogelstein (He et al ...
-
bioRxiv - Biochemistry 2022Quote: ... cloned into pMSCVpuro (Addgene #K1062-1) at Hpa1 and EcoR1 sites to create pMSCVpuro-His-mCherry ...
-
bioRxiv - Plant Biology 2019Quote: ... pYLsgRNA-AtU6-1 (Addgene ID: 66202) or pYLsgRNA-AtU6-29 (Addgene ID ...
-
bioRxiv - Developmental Biology 2021Quote: ... U6-1 and U6-3 (Addgene plasmid #83954 ...
-
bioRxiv - Developmental Biology 2020Quote: ... pLKO.1-shSCR (Addgene, Plasmid #1864), was obtained from Addgene (Cambridge ...
-
bioRxiv - Microbiology 2022Quote: ... 1 -hygro vector (Addgene, plasmid #24150) was used to generate the pLKO.1-hygro-AMOTL1-sh construct ...
-
bioRxiv - Microbiology 2022Quote: ... psPAX2 (HIV-1 gag/pol) (Addgene) and pMD2.G (encoding VSV-G ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 1 µg psPAX2 (Addgene 12260) using PEI and following standard protocol.Viral supernatant was harvested after 60 h ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 1 μg psPAX2 (Addgene 12260) using PEI and following standard protocol ...
-
bioRxiv - Immunology 2023Quote: ... pLKO.1 puro vector (Addgene, #8453) expressing control or Il5ra shRNAs ...
-
bioRxiv - Biochemistry 2023Quote: ... and PSPAX2 (1 μg, Addgene 12,260) in 600 μL per plate OPTIMEM and Lipofectamine 2000 transfection reagent (Invitrogen 11668027 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 μg pCXLE-hSK (Addgene #27078), and 1 μg pCXLE-hOCT3/4-shP53 (Addgene #27077 ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 μg pMD2.G (AddGene G12259) and 3 μg psPAX2 (AddGene 12260 ...
-
bioRxiv - Molecular Biology 2023Quote: The pLKO.1 (Addgene plasmid #13425) lentiviral vector carrying the neomycin resistance gene was used to express shRNA sequences in targeted cells ...
-
bioRxiv - Biochemistry 2023Quote: ... pLenti-CMV-Hygro (w117-1) (Addgene, 17454 a gift from Eric Campeau & Paul Kaufman) ...
-
bioRxiv - Cell Biology 2021Quote: Plasmids encoding the SARS-CoV-2 open reading frames proteins and eGFP control were a kind gift of Nevan Krogan (Addgene plasmid #141367-141395). Plasmids were acquired as bacterial LB–agar stabs ...
-
bioRxiv - Neuroscience 2021Quote: ... and SAD-B19 helper proteins (N, 52.11 mg, Addgene 59924; P, 30.15 mg, Addgene 59925; L, 23.70 mg, Addgene 59922; G, 20.26 mg, Addgene 59921). Cells were maintained with DMEM with GlutaMAX supplement ...