Labshake search
Citations for Addgene :
1401 - 1450 of 2238 citations for Human Mitochondrial Genome Maintenance Exonuclease 1 MGME1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 virus (500 nL, titer ≥ 1X1013 vg/mL, working dilution 1:5, Addgene, #100833-AAV9 ...
-
bioRxiv - Neuroscience 2021Quote: ... 500–550 nl of AAV9-Syn-jGCaMP7f-WPRE virus (diluted 1:2; Addgene) was injected in dorsal CA1 to express synapsin-driven calcium sensor jGCaMP7f (injection coordinates ...
-
bioRxiv - Developmental Biology 2021Quote: ... Guide RNA (Supplementary table 1) were cloned into pCFD3-dU6:3gRNA (Addgene 49410) digested by BbsI using annealed oligonucleotides (Integrated DNA Technology™) ...
-
bioRxiv - Biochemistry 2020Quote: pHA#847: mec-4p∷hrp-1mScarlet∷hrp-1 3’UTR (Addgene ID: 139201)
-
bioRxiv - Cell Biology 2021Quote: ... Cloning of shRNAs was conducted according to the pLKO.1 protocol (Addgene 2006). YAP 6SA was subcloned into pLJM1 by PCR amplification using primers (For ...
-
bioRxiv - Cell Biology 2022Quote: ... 1–2 (lenti-TRE3G-ApaLI(*)-Hygro) were cloned into LT3REVIR (Addgene Plasmid #111176) by inserting mito-ApaLI(* ...
-
bioRxiv - Neuroscience 2022Quote: The following viruses and were used: AAV2/1-hSyn-flex-ChR2-eYFP (Addgene), AAV-pgk-retro-Cre (Addgene) ...
-
bioRxiv - Systems Biology 2023Quote: ... 31 were transduced with pLenti PGK V5-luciferase (w528-1) blast (Addgene #19166) and selected with 10 µg/ml blasticidin (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2023Quote: ... and further sub-cloned into pLenti CMV Blast DEST (706-1) (Addgene, #17451) (Campeau et al ...
-
bioRxiv - Neuroscience 2023Quote: ... and calcium indicator jRCaMP1b (AAV1.Syn.NES-jRCaMP1b.WPRE.SV40) (Addgene, titer ≥ 1×10¹³ vg/mL) were mixed in a 1:1 ratio and vortexed immediately prior to intracranial infusion surgeries.
-
bioRxiv - Neuroscience 2023Quote: ... ≥ 1 x 1013 vg/mL) or AAV1-Ef1a-DIO eNpHR 3.0-EYFP (Addgene: 26966-AAV1 ...
-
bioRxiv - Biophysics 2023Quote: ... the StuI and XmaI restriction sites in plasmid pENTR4-HaloTag (Addgene #W876-1) were changed into a silent mutation following standard cloning techniques using primers TL-019-TL-020 and TL-023-TL-024 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/1-DIO-EF1α-mKate2-biPAC (Boston Children’s Hospital Vector Core; Addgene 169127) was unilaterally injected in the PVH of MC4R-2A-Cre mice (150 nl ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/1-DIO-EF1α-mKate2-biPAC55 (Boston Children’s Hospital Vector Core; Addgene 169127) and AAV2/1-hSyn-DIO-GreenDownwardcADDis (Boston Children’s Hospital Vector Core ...
-
bioRxiv - Cancer Biology 2023Quote: pLKO-Tet-puro-hRAF1-shRNA-1 was a gift from Ayaz Najafov (Addgene plasmid # 185371 ...
-
bioRxiv - Developmental Biology 2023Quote: ... TIR-1 was amplified from plasmid pLZ31 (Zhang et al., 2015) (Addgene #71720) and cloned under control of the hlh-3 promoter in pSL780 (Bone et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... diluted to 1/2) or AAV-Ef1a-mCherry (#114470-AAV9, obtained from Addgene; titer ...
-
bioRxiv - Neuroscience 2023Quote: ... We injected 50-100 nL of AAV (AAV2/1-Syn-jGCaMP8m-WPRE, Addgene #162375 or AAV2/1-Syn--GCaMP6s-WPRE-SV40 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/1-DIO-EF1α-mKate2-biPAC (Boston Children’s Hospital Vector Core; Addgene 169127), AAV2/1-EF1a-DIO-mKate2-PDE4D3-Cat (Boston Children’s Hospital Vector Core ...
-
bioRxiv - Cancer Biology 2023Quote: Lentiviral gene-specific shRNAs were prepared in pLKO.1-puro backbone (Addgene # 8453) (identified from verified sequences at https://www.sigmaaldrich.com/US/en/product/sigma/shrna ...
-
bioRxiv - Neuroscience 2023Quote: ... mixed at a 5:1 ratio with pCMV(CAT)T7-SB100 (Addgene #34879), and co-transfected to HEK293T cells using TransIT-293 (Mirus) ...
-
bioRxiv - Genetics 2023Quote: ... or an EcoRI-digested pLKO.1 backbone using T4 DNA ligase (Addgene #8453). To generate intein-split PE plasmids ...
-
bioRxiv - Neuroscience 2023Quote: ... A viral vector (AAV9.Syn.GCaMP6f.WPRE.SV40; Addgene, 1:10 dilution with PBS and mannitol) was then injected through a thin glass pipette with a micropump (UMP-3 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/1-DIO-EF1α-mKate2-biPAC (Boston Children’s Hospital Vector Core; Addgene 169127) was injected bilaterally into the PVH of MC4R-2A-Cre mice (150 nl ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/1-DIO-EF1α-mKate2-biPAC (Boston Children’s Hospital Vector Core; Addgene 169127), together with either AAV1-Syn-Flex-GCaMP6s-WPRE-SV40152 (Addgene 100845-AAV1 ...
-
bioRxiv - Biochemistry 2023Quote: ... and pGEX-6P-1-INTS3-FL (INTS3) were gifts from Yuliang Wu (Addgene plasmids #128307 ...
-
bioRxiv - Neuroscience 2023Quote: ... guillardia theta anion-conducting channelrhodopsin (stGtACR; hSyn1-SIO-stGtACR2-FusionRed; serotype 1; RRID:Addgene_105677) or eYFP alone as a control (AAV-EF1a-DIO-eYFP ...
-
bioRxiv - Neuroscience 2023Quote: ... 500 nL of AAV2/9-hSyn-GCaMP6s (Addgene, titer ≥ 1×1013 vg/mL) was pressure injected into each ocular vitreous through a glass micropipette using a Nanoject (Drumond Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... YAP-targeting shRNA vectors 1 and 2 refer to pLKO1-shYAP1 (Addgene, #27368) and pLKO1-shYAP2 (Addgene ...
-
bioRxiv - Biophysics 2023Quote: ... pLenti CMV rtTA3 Hygro (w785-1) was a gift from Eric Campeau (Addgene plasmid #26730 ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.50 µL of AAV5.FLEX.ArchT.tdTomato (diluted 1:2 with dPBS; Addgene number: 28305) was injected in basal forebrain of ChAT-Cre animals using the coordinates described above ...
-
bioRxiv - Neuroscience 2024Quote: AAV serotype 1 EF1a-FLEx-taCasp3-TEVp (5.8 × 1012 gp/mL) (Addgene #45580)49
-
bioRxiv - Neuroscience 2024Quote: AAV serotype 1 hSyn-SIO-stGtACR2-FusionRed (1.9 × 1013 gp/mL) (Addgene #105677)83
-
bioRxiv - Cell Biology 2024Quote: The pLKO.1 – TRC cloning vector was a gift from David Root (Addgene plasmid # 10878 ...
-
bioRxiv - Neuroscience 2023Quote: We used AAV9-CaMKIIa-hM4D(Gi)-mCherry (titer: 1×10¹³ vg/mL, Addgene) and AAV9-CaMKIIa-EGFP (titer ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then transfected with 0.5 to 1 μg pCDNA3-HA-hMYCN (Addgene #74163) using JetPrime® (Polyplus Transfection ...
-
bioRxiv - Neuroscience 2024Quote: ... or diluted (1:10 in saline) AAV1-ChrimsonR (Addgene; 1012 vg/mL titre) was co-injected with retrograde GFP (rgGFP ...
-
bioRxiv - Cell Biology 2024Quote: ... and cofilin-1-EGFP (cat no. 50859) were purchased from Addgene (Watertown, MA).
-
bioRxiv - Developmental Biology 2021Quote: ... The predicted r-opsin1 TALENs were constructed in vitro using Golden Gate assembly protocol (Golden Gate TAL Effector Kit 2.0, Addgene #1000000024) [88] ...
-
bioRxiv - Cell Biology 2023Quote: ... Targeting sequence was cloned into pDD162 plasmid by using NEB’s Q5 Site-Directed Mutagenesis Kit to insert the targeting sequence into our Cas9-sgRNA construct (Addgene #47549) by using forward primer 5’-(CAAGCGAAAGAGTCGTCGAA)GTTTTAGAGCTAGAAATAGCAAGT-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... Expression plasmids for WT and catalytic mutant mouse Lipin-1 were obtained from Addgene. Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... and then recombined into the destination vector pLenti CMV Blast DEST (706-1, Addgene) plasmid ...
-
bioRxiv - Cell Biology 2022Quote: RPE-1 cells were transfected using 0.25µg pCMVHA E2F1 (24225 from Addgene, RRID: Addgene_24225) with a JET PRIME kit (Polyplus Transfection ...
-
bioRxiv - Cell Biology 2022Quote: RPE-1 cells were transfected using 0.25µg pCMVHA E2F1 (24225 from Addgene, RRID: Addgene_24225) with a JET PRIME kit (Polyplus Transfection ...
-
bioRxiv - Genomics 2020Quote: ... and pMA122 - peel-1 negative selection (Addgene plasmid # 34873; http://n2t.net/addgene:34873; RRID:Addgene_34873) were gifts from Dr ...
-
bioRxiv - Genetics 2020Quote: ... the NLS:LEXA (1-214aa) fragment from the pBPnlsLexA::GADflUw plasmid [35] (Addgene plasmid #26232) was cloned in frame in a myc-BAP170 (2-1688 aa ...
-
bioRxiv - Molecular Biology 2019Quote: ... RACK1-FLAG was cloned into pLenti CMV Puro DEST (w118-1) (Addgene plasmid #17452) following the manufacturer’s protocol ...
-
bioRxiv - Physiology 2019Quote: ... pcDNA4 myc PGC-1 alpha was a gift from Toren Finkel (Addgene plasmid # 10974). pSG5 PPAR alpha was a gift from Bruce Spiegelman (Addgene plasmid # 22751) ...
-
bioRxiv - Biochemistry 2019Quote: ... and pFLAG-SREBP2Nt (N-terminal transcriptionally active domain, amino acids 1-482) (Addgene, 26807) were used to transfect cells (HEK293) ...
-
bioRxiv - Neuroscience 2019Quote: The plasmids used for transfection were listed (1) cis plasmid pAAV.hSyn.eGFP.WPRE.bGH (Addgene Cat# 105539) and pAAV-hSyn-eGFP (Addgene Cat# 50465) ...