Labshake search
Citations for Addgene :
1401 - 1450 of 1661 citations for 3RS 4 Dimethylamino 3 methyl 2 2 diphenylbutanenitrile Isodidiavalo since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... the short guide RNAs (sgRNAs) targeting the signaling peptide (5’-GAGTAGCGCGAGCACAGCTA - 3’) was cloned into lentiCRISPR v2 (a gift from Feng Zhang; Addgene plasmid # 52961 ...
-
bioRxiv - Molecular Biology 2020Quote: ... the guide RNA targeting HDAC6 exon 5 (5’-GAAAGGACACGCAGCGATCT-3’) was selected and constructed into LentiCRISPRv2 vector (Addgene plasmid 52961). The HDAC6-KO vector can also express the codon-optimized Cas9 protein as well as puromycin resistance gene ...
-
bioRxiv - Immunology 2022Quote: ... HHLA2 cDNA included 5’ EcoRI and 3’ NotI sites and was cloned into the pBMN-IRES-GFP vector (Addgene #1736). PCR (Q5 enzyme ...
-
bioRxiv - Cell Biology 2022Quote: The sgRNA oligomers for SLC25A46 targeting exon 1 and 3 were annealed and inserted into plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 from Addgene (62988) via combined ligation (T7 ligase NEB).
-
bioRxiv - Cell Biology 2022Quote: ... The sgRNA expression vectors were generated by cloning appropriate DNA oligonucleotides (Suppl. Table 3) in the BbsI restriction sites of pX459 (#62988, Addgene). An empty pX459 vector was used to generate matching negative control cell lines ...
-
bioRxiv - Neuroscience 2022Quote: ... using an ultra-fine dental drill and inserted a glass pipette backfilled with AAV2-CamkIIa-hChR2(H134R)-EYFP (titer: 3×10¹² viral genomes per ml, 26969-AAV2, Addgene). AC was approached similar to extracellular recordings ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV9-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA (300 nL; 3×1011 GC/ml; Serotype:9; Addgene, Massachusetts, USA) was unilaterally injected into the right MePD using a 2-μL Hamilton micro syringe (Esslab ...
-
bioRxiv - Neuroscience 2022Quote: Virus expression: pulled glass pipettes were used to inject 500nL of AAV5-mDIx-Chr2-mCherry-Fishell-3 (plasmid no.83898, Addgene, USA ...
-
bioRxiv - Molecular Biology 2024Quote: To generate RAD54L2 knockouts a double-stranded DNA oligo encoding a sgRNA targeting the RAD54L2 5’ region from the TKOv3 library (Hart et al, 2017) (5’-AAGATGGGCAGCAGCCGCCG CGG–3’) was cloned into pSpCas9(BB)-2A-Puro (PX459) (RRID: Addgene_48139) to yield PX459-RAD54L2.
-
bioRxiv - Neuroscience 2024Quote: ... Either AAV-CAG-FLEXFRT-ChR2(H134R)-mCherry (n = 7, 200 nL, 3 × 1012 GC/mL, Serotype: 9; Addgene, MA, USA) to express channelrhodopsin (ChR2 ...
-
bioRxiv - Neuroscience 2024Quote: ... the ReaChR virus was co-injected unilaterally into the LC with AAV9-hSyn-FLEX-jGCaMP8m (3 × 1013 gc/mL, 162378-AAV9 from Addgene) or with AAV9-hSyn-GRABNEm (2-9 × 1013 gc/mL ...
-
bioRxiv - Neuroscience 2024Quote: ... From 5’ to 3’ the constructs consist of a Tet-On doxycycline inducible promoter (a gift from David Root (Addgene plasmid # 41393 ...
-
bioRxiv - Genomics 2024Quote: ... and the top 3 sgRNAs were individually cloned into single sgRNA expression vectors with direct capture cs1 sequences (Addgene # 122238)10 using restriction digest (BstXI and BlpI ...
-
bioRxiv - Developmental Biology 2024Quote: ... MegaGate was utilized to insert ORFs into the final PB-cT2G-cERP2 3’ UTR barcode-modified expression vectors (Addgene 175503). Three unique barcodes were selected for each ORF with an average hamming distance of six ...
-
bioRxiv - Genetics 2024Quote: HeLa CRISPRi cells were generated by lentiviral integration (∼3 to 5 MOI) using the dCas9-KRAB-blast plasmid (Addgene #89567), followed by single cell isolation ...
-
bioRxiv - Molecular Biology 2023Quote: ... The sequence of a single guide RNA (sgRNA) specifically targeting the 3’ end of TGRH88_003980_t1 was integrated into pSAG1::CAS9-GFPU6::sgUPRT (Addgene plasmid # 54467) using the Q5-site directed mutagenesis kit (NEB) ...
-
bioRxiv - Cell Biology 2023Quote: ... The PAC sgRNA (5′-TGTCGAGCCCGACGCGCGTG-3′) (Lambrus et al., 2016) was cloned into the pSpCas9(BB)-2A-GFP (PX458; 48138; Addgene) vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’ ...
-
bioRxiv - Genomics 2023Quote: ... we designed a gRNA that targets the 3’ end of the SOX2 stop codon (Supplementary Table S25, Addgene plasmid #163752). We then amplified ∼800 bp homology arms upstream and downstream of the gRNA target sequence using high-fidelity Phusion Polymerase ...
-
bioRxiv - Cell Biology 2023Quote: ... embryos were electroporated at DIV0 just before plating with 3 µg of the plasmid control encoding for Td-tomato alone (pCAG td Tomato, Addgene) or 3 µg of plasmid encoding for Cre-recombinase and reporter gene Td-tomato (pCAG td Tomato-Ires-Cre ...
-
bioRxiv - Molecular Biology 2023Quote: - recombinant pGEX-4T-3-P53: The human-p53 cDNA was previously cloned in the EcoRI site of pGEX-4T3 (Addgene_79149) under the lac-trp hybrid promoter that is inducible by IPTG ...
-
bioRxiv - Neuroscience 2023Quote: Ntsr1-Cre mice (n = 3) were stereotaxically injected with an inhibitory opsin (AAV1-hSyn-SIO- stGtACR2-FusionRed, 5 x 1011 vg/ml, Addgene) see “Virus injection and optical fiber implantation” 6 weeks prior to the recordings ...
-
bioRxiv - Cell Biology 2023Quote: eGFP with three perfect miR430 target sites in its 3’UTR (eGFP-3xPT-miR430b) was inserted in the pCS2+ plasmid (Addgene) as described before 24 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The guide sequence used was 5’-TCTCTGAGTGCCAACGCGCG-3’ and was cloned into the BbsI site of pX459 vector (Addgene #62988). The gene targeting was performed by co-transfection of pX459 and the synthetic donor vector into B6N 6.0 embryonic stem cells using Lipofectamine 2000 ...
-
bioRxiv - Biochemistry 2023Quote: The 6xHis-SUMO-14-3-3ζ construct used in this work (kind gift of prof. B.M. Burmann) was derived from GST-14-3-3ζ (Addgene #13278)26 ...
-
bioRxiv - Biophysics 2023Quote: Fusion constructs with pTREtight2 vectors were co-transfected with reverse tetracycline-controlled transactivator 3 (pLenti CMV rtTA3 Hygro (w785-1)) plasmid (Addgene) in the presence of doxycycline (Clontech) ...
-
bioRxiv - Biochemistry 2023Quote: ... IGF2BP3: 5’-ACGCGTAGCCAGTCTTCACC-3’) were cloned into the pSpCas9 (BB)-2A-GFP (PX458) (plasmid #48138; Addgene, (Ran et al. 2013)) ...
-
bioRxiv - Neuroscience 2023Quote: ... we inserted a barcode sequence consisting of 20 random nucleotides in the 3’ untranslated region of the nucleoprotein gene in pRVΔG-4mCherry (Addgene #52488) (SAD B19 strain ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The AND gate constructs were optimized by making constructs with ribosome binding site library (5’-GAAAGANNNGANNNACTA-3’) in front of regulators in chemically competent Marionette Clo cells prepared from Addgene [40] ...
-
bioRxiv - Neuroscience 2024Quote: ... -2.2 mm ventral from skull under an angle of 10°) and injected with AAV5-hSyn-DIO-mCherry (3*10^12 gc/ml; 300nl; Addgene) in LHA (-1.3 mm posterior to bregma ...
-
bioRxiv - Cell Biology 2024Quote: The monoclonal SK-N-DZ SCLYKO cell line was transduced with Toronto KnockOut (TKO) CRISPR Library - Version 3 (Addgene, 90294) at MOI of 0.3 ...
-
bioRxiv - Molecular Biology 2024Quote: We cloned two previously published gRNA sequences (13) targeting 5’ or 3’ of the SCR into a Cas9 expressing px330 backbone (#158973, Addgene) according to the protocol published by the Zhang lab (38) ...
-
bioRxiv - Molecular Biology 2024Quote: To generate CRISPR/Cas9-mediated knockout lines, the sgRNA targeting TRIM37 (TRIM37Δ, 5′-ctccccaaagtgcacactga-3′) was cloned into the PX459 vector (#62988; Addgene) containing a puromycin resistance cassette ...
-
bioRxiv - Microbiology 2024Quote: ... second transduction was performed 3 days after the addition of puromycin using pLenti SpBsmBI sgRNA Hygro vector (Addgene, Plasmid # 62205) harboring the IMPDH2 sgRNA ...
-
bioRxiv - Neuroscience 2024Quote: ... For the VIP silencing experiments (Figure 7H) 3 VIP-Cre mice were injected with a mixture of viruses expressing GcaMP7f (pGP-AAV9-syn-jGCaMP7f-WPRE, Addgene) and Cre-dependent ArchT (pAAV-FLEX-ArchT-tdTomato (AAV5) ...
-
bioRxiv - Cell Biology 2024Quote: ... The RNAi clone that targets the 3’UTR of cdc-42 was generated through amplification of genomic cdc-42 3’UTR (Fwd: gaagatctgaacgtcttccttgtctccatgt; Rev: ggggtaccacgtaacggtgtatccggac) and insertion into the L4440 plasmid (#1654 Addgene). Control bacteria is transformed with empty L4440 vector (#1654 Addgene).
-
bioRxiv - Cancer Biology 2024Quote: ... targeting a DNA sequence within the first exon of the FasL gene (5’-CTGGGCACAGAGGTTGGACA-3’) was cloned into the BsmBI restriction site of the 3rd generation LentiCRISPR.V2 (Addgene, #52961) vector ...
-
bioRxiv - Cell Biology 2024Quote: ... and 3 µg of mouse Lamin B1 or Lamin B2 or Lamin B3 plasmids conjugated with myc-tag (pCS2-MT, Addgene). Cells were incubated for 48h in a DMEM cultivation medium (Gibco ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... . The 293 T cells were transfected with pLVX-TFAP2B-3×Flag together with psPAX2 and pMD2.G lentiviral packaging systems (Addgene) to generate TFAP2B stably overexpressed cell lines.
-
bioRxiv - Neuroscience 2024Quote: ... sequence along with the P2A sequence (2A peptide from porcine teschovirus-1 polyprotein) at the 3’ end was obtained via PCR from Addgene plasmid #129102 and fused in-frame with the mTurquoise2 DNA sequence in the same plasmid backbone as the pAAV-hSyn-mTurquoise2 plasmid ...
-
bioRxiv - Biochemistry 2024Quote: ... An oligonucleotide corresponding to a target sequence near the smo-1 translational start site (sgRNA #1: 5‘ GCCGATGATGCAGCTCAAGC 3‘) was cloned into the plasmid pMW46 (derivate of pDD162 from Addgene). The deletion of the eleven amino acids ADDAAQAGDNA at the SMO-1 N-terminus was achieved using the oligonucleotide pAF64 as repair template ...
-
bioRxiv - Neuroscience 2024Quote: ... The lentiviral construct for RELN expression was generated by subcloning domains 3–6 (central domains) of RELN from the pCrl construct (Addgene #122443 ...
-
bioRxiv - Biochemistry 2024Quote: ... a pooled library of synthetic 3’ UTRs was cloned downstream of eGFP in the pCDNA5/FRT/TO plasmid (Addgene 19444). Each 3’ UTR consisted of a 19-nucleotide fixed spacer ...
-
bioRxiv - Cell Biology 2024Quote: ... HT29 parental cells were transfected with pMA-T-gRNA-RIP1-3 (synthetic construct expressing the guide) targeting RIPK1 and Cas9-GFP (pSpCas9(BB)-2A-GFP (PX458, Addgene). The Cas9-target sites are ...
-
bioRxiv - Developmental Biology 2024Quote: The lentiviral construct for RELN expression was generated by subcloning domains 3–6 (central domains) of RELN from the pCrl construct (Addgene #122443 ...
-
bioRxiv - Cell Biology 2020Quote: ... pLenti [CM V/GFP/Hygro] (656-4) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17446). The cut backbone vector was treated with Antarctic Phosphatase (cat# M0289S ...
-
bioRxiv - Neuroscience 2021Quote: ... Subset of pups were bilaterally injected with 4 μl AAV9-hsyn-EGFP (3.4×10^13 gc/ml, Addgene) or 4 μl ACh3.0 (1.8×10^13 gc/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau and Paul Kaufman (Addgene plasmid #17446; http://n2t.net/addgene:17446; RRID:Addgene_17446)65 ...
-
bioRxiv - Biochemistry 2022Quote: HEK293T cells were transiently transfected with pGP-CMV-GcAMP6s (Ca2+ Sensor plasmid, Addgene, Cat. no. 40753; 4 µg), 5HT2c receptor (as positive control ...
-
bioRxiv - Cell Biology 2021Quote: ... and subcloned into pLenti-CMV-GFP-Hygro (656-4) (gifted from Eric Campeau & Paul Kaufman; Addgene plasmid # 17446) using NEBuilder® HiFi DNA Assembly Kit (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: The genome-wide Brie CRISPR-KO library (4 sgRNAs per gene; ~ 80.000 sgRNAs) was purchased from Addgene (#73632) and amplified according to the supplier’s protocol ...