Labshake search
Citations for Addgene :
1351 - 1400 of 1992 citations for Mouse Anti HIV 1 p24 Recombinant Antibody clone 183 H12 5C since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 4-363h21C1 and 3-978h1C1 and were cloned into lentiviral vector pLKO.1-puro (Addgene, catalogue #8543). Lentiviral vectors were produced in 293T cells by Fugene transfection and the supernatant was used to infect Jurkat cells ...
-
bioRxiv - Biochemistry 2020Quote: ... and for luciferase assays a ratio of 1:9:10 HA-Clover plasmid:pcDNA(-):HRE-Luciferase (Addgene #26731) was used (physiological expression levels) ...
-
bioRxiv - Biochemistry 2021Quote: NF1 (isoform 1) was subcloned from R777-E139 Hs.NF1 (a gift from Dominic Esposito, Addgene plasmid #70423) as an N-terminal His6-tagged protein in pFastBac1 (Invitro-gen) ...
-
bioRxiv - Cell Biology 2020Quote: Specific shRNA1 and shRNA2 targeting human ARID1A were cloned into the pLKO.1-TRC-puro vector (Addgene), separately ...
-
bioRxiv - Developmental Biology 2020Quote: 1 kb homology arms were generated through PCR and cloned into the pHD-dsRed-attP (Addgene #51019). Guide RNAs and the donor vector were co-injected into vas-Cas9 embryos (BDSC #51324 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The GFP1-10 and GFP11×7 fragments were obtained from plasmids pcDNA3.1-GFP(1-10) (Addgene: 70219) and pACUH-GFP11×7-mCherry-α-tubulin (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmid BK Dunlop and JC Mad-1 were gifts from Peter Howley (Addgene plasmids # 25466 and #25626) and were used as positive controls for 1:1 VP1/Large T-antigen copy number ...
-
bioRxiv - Genetics 2020Quote: The plasmid that contains the isoform 1 of human DNMT3B (DNMT3B1) was purchased from Addgene (cat # 35522). The DNMT3B1 cDNA was then fused to an N-terminal Flag tag by PCR ...
-
bioRxiv - Immunology 2022Quote: ... gene specific target sequences (available upon request) were cloned into the lentiviral vector pLKO.1-puro (Addgene) as described in (Tsopoulidis ...
-
bioRxiv - Microbiology 2023Quote: ... was combined with 1 ug lenti CRISPR V2 plasmid (a gift from Feng Zhang, Addgene plasmid #52961) expressing the guide RNA (gRNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... was generated by Gibson assembly of the following fragments: the EF-1 alpha promoter (from Addgene #2261), the Kozak-3XFLAG fragment (from c3GIC9 ...
-
bioRxiv - Microbiology 2023Quote: ... An inducible GFP was made by inserting the Yersinia operon 1 promoter sequence into plasmid pFCcGi (Addgene) upon restriction with HindIII and XbaI (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLenti CMV GFP Blast (659–1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17445). pHAGE-PIK3CA-H1047L was a gift from Gordon Mills & Kenneth Scott (Addgene plasmid # 116499 ...
-
bioRxiv - Cancer Biology 2023Quote: ... High complexity barcoding library LARRY Barcode Version 1 library79 was a gift from Fernando Camargo (Addgene #140024). Retroviral stocks were generated using pCL-Eco plasmid ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sequences (shPROX1-1: TGCTGTTGACAGTGAGCGCGAGGACCAAGATGTCATCTCATAGTGAAGCCACAGATGTATGAGATGAC ATCTTGGTCCTCATGCCTACTGCCTCGGA; shPROX1-2: TGCTGTTGACAGTGAGCGCCCCCGAGAAAGTTAC AGAGAATAGTGAAGCCACAGATGTATTCTCTGTAACTTTCTCGGGGATGCCTACTGCCTCGGA) were cloned into the LT3GEPIR backbone100 (Addgene; 111177) and used to generate lentiviral particles to transduce into organoids as described99 ...
-
bioRxiv - Neuroscience 2023Quote: ... to induce expression of Voltron2-ST and a 1:150 dilution of AAV9-hSyn-Cheriff-EGFP (Addgene plasmid #51697 ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLenti-CMV-GFP-Blast (659-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17445). pRL-SV40P was a gift from Ron Prywes (Addgene plasmid # 27163) ...
-
bioRxiv - Cancer Biology 2023Quote: ... A CRISPR/dCas9 vector was constructed as follows: pX330A_dCas9-1×2 (Addgene, Watertown, MA; plasmid ID 63596) (20 ...
-
bioRxiv - Plant Biology 2023Quote: ... fw2.2-sgRNA-1 and fw2.2-sgRNA-2 were fused to the Arabidopsis AtU6-26 promoter (Addgene #46968) by digestion-ligation reaction in plCH47751 (Addgene #48002 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... we have cloned their respective oligonucleotides in following vectors: PDX1 in pX330A-1×5 (Plasmid #58769, Addgene), NKX6.1 in pX330S-2 (Plasmid #58778 ...
-
bioRxiv - Cell Biology 2022Quote: ... Small hairpin RNAs (shRNA) targeting sequences for specific genes were cloned in pLKO.1-Puro vector (Addgene). Upon production by 293T cells ...
-
bioRxiv - Neuroscience 2024Quote: ... GABAergic interneuron targeting was achieved with 0.45 µl of AAV1-1/2mDlx-HBB-hChR2-mcherry (Addgene 83898) (viral titer 7×1012 vg per ml ...
-
bioRxiv - Neuroscience 2024Quote: ... stereotactic injection of EnVA-CVS-N2c-dG-H2B-tdTomato (70 nL; dilution 1/10, Addgene plasmid: #175441)19 was performed at P30 in animals previously injected with AAV-3xgRNA-DIO-TVA-N2cG at P0 (80 nl) ...
-
bioRxiv - Developmental Biology 2024Quote: ... The HDR plasmid containing ippk-1 homology arms and the GFP and selection cassette (pDD282, Addgene #66823) was made using Gibson Assembly as described in Dickinson et al ...
-
bioRxiv - Plant Biology 2023Quote: ... These two level 1 vectors were assembled with the Kanamycin resistance gene (pNOS::NPTII-OCST; Addgene #51144), the AtCas9 (2×35S::AtCAS9-OCST ...
-
bioRxiv - Microbiology 2023Quote: ... The wild-type (Flag-SIRT1) and mutant (Flag-SIRT1 H363Y) SIRT-1 plasmids were purchased from Addgene and transfected into cells using Lipofectamine 2000 ...
-
bioRxiv - Microbiology 2023Quote: pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 8453; http://n2t.net/addgene:8453; RRID:Addgene_8453)75 ...
-
bioRxiv - Molecular Biology 2023Quote: shRNA oligonucleotides targeting FEN1(shown in the following table) were cloned into pLKO.1 (Cat# 8453, Addgene) digested with EcoRI and AgeI ...
-
bioRxiv - Cancer Biology 2023Quote: the NF1 isoform 1 recombinant protein was produced in insect cells starting from the plasmid R702-X38-635 encoding for His6-Hs.NF1opt (1-2839) (a gift from Dominic Esposito; http://n2t.net/addgene:159576; RRID:Addgene_159576) 33 ...
-
bioRxiv - Neuroscience 2023Quote: ... human CaV2.2 (huCaV2.2 (pSAD442-1) was a gift from Diane Lipscombe (Addgene plasmid # 62574; http://n2t.net/addgene:62574; RRID:Addgene_62574)) ...
-
bioRxiv - Biochemistry 2023Quote: Lentiviral vector pLH3 was constructed by replacing the U6 promoter in pLKO.1 GFP shRNA (Addgene #30323) with the CMV promoter in pKH3 (Addgene #12555 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The oligos were annealed and cloned into the pLKO.1 hygro vector from Addgene (plasmid no. 24150).
-
bioRxiv - Genetics 2022Quote: ... 1 kb homology arms were generated through PCR and cloned into the pHD-dsRed-attP (Addgene #51019) [73] ...
-
bioRxiv - Neuroscience 2022Quote: ... versus a respective control virus AAV2/1-DIO-hSYN1-mCherry (Addgene # 50459; titer: 9 × 1012 gc/ml). To ablate PVNOT neurons ...
-
bioRxiv - Microbiology 2023Quote: ... the puromycin N-acetyltransferase (PAC) gene was amplified from pLenti CMV Puro DEST (w118-1) (Addgene #17452) by PCR ...
-
bioRxiv - Physiology 2023Quote: ... pAAV-GfaACC1D.Lck-GCaMP6f.SV40 (1.53×1013 vg/ml, working dilution 1:5, Addgene plasmid #52925-AAV5; http://www.addgene.org/52295/; RRID: Addgene_52925) was a gift of Baljit Khak ...
-
bioRxiv - Developmental Biology 2023Quote: ... CRISPR guide RNAs (gRNAs) targeting exon 1 of SLC25A1 were subcloned into lentiCRISPR v2 (Addgene Plasma 52961) using BbsI sites as described.33,40 Non-targeting guides were generated using previously reported sequences.
-
bioRxiv - Genomics 2022Quote: ... The open reading frames of H3 and H4 were cloned in the Dox-inducible expression vector KA0717 (KA0717_pPB-hCMV*1-cHA-IRESVenus was a gift from Hans Schöler, Addgene plasmid #124168; http://n2t.net/addgene:124168; RRID:Addgene_124168) fused at their 3’ end in frame to the sequence of the yellow fluorescent protein (YFP ...
-
bioRxiv - Developmental Biology 2023Quote: ... nls::Cas9::nls (subcloned from Eef1a-1955/- 1>nls::Cas9::nls a gift from Lionel Christiaen, Addgene plasmid # 59987 ;http://n2t.net/addgene:59987 ...
-
bioRxiv - Neuroscience 2023Quote: 1-4 evenly spaced ∼60 nl injections of the AAV1-synapsin-l-GCamp6f (Addgene, MA stock #100837) that had been diluted to a titer of ∼1×10^12 vg/mL using sterile PBS were made in each cranial window ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... coding for the large T oncogene SV40 (V40 1: pBSSVD2005 was a gift from David Ron; Addgene plasmid #21826 ...
-
bioRxiv - Plant Biology 2024Quote: ... Binomica Labs) with primers for Golden Gate assembly into the Level 1 pICH47742 plasmid (Addgene catalog # 48001) with a double 35S promoter (pICH51277 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and EGFP control (See Supplemental Table 1 for sgRNA sequences for each)) into lentiCRISPR v2 (Addgene #52961). For individual gene knockouts pooled libraries of up to four sgRNAs were generated ...
-
bioRxiv - Immunology 2024Quote: ... DLD-1 wild type cells were transduced with pLenti-CMV-MCS-RFP-SV-puro (Addgene plasmid #109377) viral particles (DLD-RFP ...
-
bioRxiv - Immunology 2024Quote: ... and proIL-1β were cloned from PMA-differential THP-1 cells and inserted into pCS2Flag (16331, Addgene)-based expression vectors with different tags ...
-
bioRxiv - Neuroscience 2024Quote: ... Each coverslip was transfected with 1 μg of either GFP or HA-UBE3A plasmid (Addgene, cat. #8648), and 1 μL Lipofectamine 2000 ...
-
bioRxiv - Neuroscience 2024Quote: ... PV-ChR2 mice were injected with 1µl of AAV-CaMK2-GCaMP6f (Addgene, #100834-AAV9, dilution 1/15) at 0.75µl.min−1 in the left primary auditory cortex (centered at 1.75 mm anterior to the inter-section of the lambdoid and interparietal-occipital sutures ...
-
bioRxiv - Neuroscience 2024Quote: ... n=2) or AAV9.EF1a.dflox.hChR2(H134R).EYFP.WPRE.HGH (1×10^12 pp/mL, Addgene, cohort 2, n=2). Subject mice were additionally injected in vCA2 (AP −3.0 ...
-
bioRxiv - Biochemistry 2024Quote: Human interferon-induced protein with tetratricopeptide repeats 1 (IFIT1) gene (Gene ID: 3434) was obtained from Addgene in the plasmid vector pET28a_IFIT1 ...
-
bioRxiv - Neuroscience 2024Quote: ... DV: -0.4) and 0.3μl of AAV.PHP.eB-CAG-DIO-tdTomato (28306-PHPeB, Addgene, 1×10¹3 vg/mL) was injected at a rate of 0.05μl/min ...