Labshake search
Citations for Addgene :
1351 - 1400 of 2679 citations for 2 Bromo 1 5 bromofuran 2 yl ethanone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO.1-neo (Addgene, 13425) was used as the backbone ...
-
bioRxiv - Neuroscience 2023Quote: ... α-syn 1-110 (Addgene #213500), α-syn 96-140 (Addgene #213501) ...
-
bioRxiv - Cancer Biology 2024Quote: ... PLKO.1 (Plasmid #8453, Addgene) backbone was used ...
-
bioRxiv - Neuroscience 2023Quote: ... α-syn 1-95 (Addgene #213499), α-syn 1-110 (Addgene #213500) ...
-
bioRxiv - Neuroscience 2022Quote: pLKO.1-TRC (Addgene, 10878) vector was used for the knockdown of YTHDF2 ...
-
bioRxiv - Cell Biology 2023Quote: ... AICSDP-1:PXN-EGFP (Addgene plasmid #87420 ...
-
bioRxiv - Cell Biology 2022Quote: ... pMA122 (peel-1, Addgene #34873), and co-injection markers were injected into N2 young adult worms ...
-
bioRxiv - Cancer Biology 2024Quote: pLKO.1 puro (Addgene #8453), pMDLg/pRRE (Addgene #12251) ...
-
bioRxiv - Cell Biology 2024Quote: ... pLKO.1-Scrambled (Addgene #136035) 100 was modified to express H2B-mRuby3 for visual identification of transduced cells based on a nuclear fluorescence signal101 ...
-
bioRxiv - Cancer Biology 2024Quote: ... pLKO.1-TRCN0000020840 (shSTAT3, Addgene), pLKO-TRCN0000280021 (shSTAT1 ...
-
bioRxiv - Cell Biology 2020Quote: ... sgRNA oligonucleotides targeting the human Pex5 locus (at 5’-GCTCGCCGGGCACTTCACCC-3’) were ligated into the BbsI site of pSpCas9(BB)-2A-GFP (PX458, Addgene Plasmid #48138) to generate pVD1629 ...
-
bioRxiv - Developmental Biology 2020Quote: ... using 500 ng of linearised plasmid that was retrieved from 5 μg of p-T3TS-nCas9n plasmid (plasmid #46757; Addgene, Cambridge, MA) digested with XbaI (New England Biolabs ...
-
bioRxiv - Developmental Biology 2020Quote: ... targeting the 5’ (5’-AGTGCGCTTCGTCACTGCAC-3’) and 3’ (5’-TCCTCCCGCCCCGACGCGGA-3’) region of the Spen ORF were cloned in the Cas9-GFP pX458 vector (Addgene plasmid #48138). Compatible 5’ and 3’ Homology arms (HA ...
-
bioRxiv - Developmental Biology 2020Quote: ... a sgRNA targeting the 3’ end of Spen ORF (5’-GATTGTCATTGCCTCGGTG-3’) was cloned in the Cas9-PuroR pX459 vector (Addgene plasmid #62988). The donor template was made using a gblock from Integrated DNA Technologies coding for compatible 5’ and 3’ HA of 600 bp with a NheI and AscI restrictions sites in-between the 5’ and 3’ HA ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AAAGTGGGACGCGGCACCTA-3’ from Zhang lab database) was cloned as synthetic dsDNA into lentiCRISPRv2 vector (provided by F. Zhang, Addgene plasmid #52961) as described (Sanjana et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... cloning to insert SOX9 5’ and 3’ homologous arms in EasyFusion T2A-H2B-GFP plasmid (a gift from Janet Rossant, Addgene plasmid # 112851). AAVS1 repair template was created by Infusion cloning to swap the CAG promoter and Puromycin resistance cassette in plasmid AICSDP-42 ...
-
bioRxiv - Developmental Biology 2021Quote: ... SOX2 knockout repair template was created by Infusion cloning to insert SOX2 5’ and 3’ homologous arms in EasyFusion T2A-H2B-GFP (a gift from Janet Rossant, Addgene plasmid # 112851). SFTPC targeting repair template was created by Infusion assembly of SFTPC 5’ and 3’ homologous arms together with T2A-Rox-EF1a-Rox-Venus-NLS ...
-
bioRxiv - Neuroscience 2021Quote: 8-12 weeks old Ucn3::Cre male (n =5) and female (n=3) mice were stereotaxically injected with AAV1-eF1a-DoubleFlox hChR2(H134R)-mCherry-WPRE-HgHpA (Addgene, Cambridge, MA) bilaterally into the PeFA (AP −0.6 ...
-
bioRxiv - Neuroscience 2020Quote: ... 2012), and followed by an eGFP-containing 5’ UTR (pGH112, Erik Jorgensen) in the destination vector pCFJ150 (Erik Jorgensen, Addgene plasmid #19329). The GCaMP6f-containing plasmid (Prig-3::GCaMP6f::unc-54 ...
-
bioRxiv - Cancer Biology 2020Quote: ... tag-containing MAP3K7 forward primer (5’-cagtGGGCCCaccATGTA CCCATACGATGTTCCAGATTACGCTAGCGGCCGCATGTCTACAGCCTCTGCCG-3’) and its reverse primer (5’-ATAggatccTCATGAAGTGCCTTGTCGTTTC-3’) were used to amplify MAP3K7 from pDONR223-MAP3K7 plasmid (Addgene plasmid #23693) and cloned into the NotI and BamHI sites of lentiviral vector pHIV-Zsgreen (Addgene plasmid #18121 ...
-
bioRxiv - Physiology 2021Quote: ... 100 U/ml penicillin and 100 ug/ml streptomycin in a 5% CO2/95% air atmosphere at 37C Plasmid GP-CMV-GCaMP6s (Addgene plasmid # 40753) was cloned into lentiviral vector pCDH-EF1-MCS-IRES (puro ...
-
bioRxiv - Microbiology 2020Quote: ... This vector expresses an endoplasmic reticulum (ER)-retained truncated Env-EGFP fusion protein. For linearization experiments (Fig. 5) we used plasmid pNL-EGFP/CMV/WPREdU3 (pNL-CMV-GFP) (Addgene, MA, USA). pNL4-3/Luc/Ori and pNL4-3/Luc/Kan were produced by molecular cloning into pNL4-3/Luc ...
-
bioRxiv - Developmental Biology 2021Quote: ... using 500 ng of linearised plasmid that was retrieved from 5 μg of p-T3TS-nCas9n plasmid (plasmid #46757; Addgene, Cambridge, MA) digested with XbaI (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... 5’- CGCGTCGACATGGTGAGCAAGGGCGAGGA-3’ and mCh REV: 5’-ACGCGGATCCCTTGTACAGCTCGTCCATGC-3’ and ligating it into pENTR4 no ccDB (gift from E. Campeau, Addgene plasmid #17424) plasmid (Campeau ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1ug of either SF3B1 sgRNA or Rosa26 sgRNA in pLKO.5 Puro-2A-GFP backbone was co-transfected with either 1ug of NG-ABE8e (Addgene plasmid 13849) or NG-ABEmax (Addgene plasmid 124163) ...
-
bioRxiv - Genomics 2024Quote: ... 5’CTTCG-AATAGAATCGCCGCCCGCT3’;antisense:3’CTTATCTTAGCGGCGGGCGACAAA5’)and(se nse:5’CTTC-GTTGTGGCTGCACAGACTGG3’;antisense:3’CAACACCGACGTGTCTGACC-CAAA5’) into the pU6-BbsI-chiRNA plasmid (Addgene no. 45946), following the protocol outlined on the flyCRISPR website ...
-
bioRxiv - Molecular Biology 2022Quote: Synthesized IRIS guide RNA oligonucleotide (target sequence: 5’-CTGGGGCAAACACAAAAACCTGG-3’) was cloned into the BsmB1 sites of the lentiCRISPRv2 vector (a gift from Feng Zhang, Addgene plasmid #52961)50 following the protocol described by Sanjana et al.50 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5’-GCGCCTCCTGCGAAGCCATCAGG-3’ and 5’-CGTAGCGGGAAGGGTCAAGAGGG-3’) were similarly cloned into the lentiCRISPRv2-hygro vector (a gift from Brett Stringer, Addgene plasmid #98291)51.
-
bioRxiv - Biophysics 2023Quote: ... followed by ligation in place of the mApple sequence in the mApple-CD36-C-10 vector (Addgene, Watertown, MA plasmid # 54874 (5)) ...
-
bioRxiv - Microbiology 2024Quote: ... sequence targeting the third exon of the human L1CAM gene (5’-GAGTAGCCGATAGTGACCTG-3’) was designed and cloned into the pKLV2-U6gRNA(BbsI)-PGKpuro2ABFP vector (Addgene plasmid #67974). For the production of lentiviral particles carrying the CRISPR/Cas9 components ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... A previously published plasmid (Brunet et al., 2021) encoding the pEFL-pac-5’Act cassette was used as a template (Addgene ID NK802). Custom primers were designed to add an 18-nucleotide premature termination cassette (5’-TTTATTTAATTAAATAAA-3’ ...
-
bioRxiv - Cancer Biology 2024Quote: ... or an sgRNA against PTEN (sgPTEN: 5’-GAC TGG GAA TAG TTA CTC CC -3’) in the LCV2-hygro backbone (Addgene Plasmid #98291), or infected with the pHRIG-AKT1 lentiviral construct (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: CRISPR donor plasmids were cloned with 0.8 kb 5’ and 3’ homology arms amplified from fly genomic DNA into pUC57(Addgene plasmid #51019, RRID:Addgene_51019), flanking the different CTail Shot-eGFP coding sequences ...
-
bioRxiv - Genetics 2024Quote: ... carrying an sgRNA (5’-AAGGAAACTAAGACGTGCGA-3’) and two plasmids carrying mAID-mClover flanked by XPG sequences and a neomycin casette (pMK289, Addgene plasmid #72827) or a hygromycin cassette (pMK290 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... donor vector (400 ng µl-1) and pHsp70-Cas9 (400 ng µl-1) (Addgene #45945) [69] ...
-
bioRxiv - Neuroscience 2020Quote: ... We then injected the AAV5.CamKII.GCaMP6f.WPRE.SV40 virus (Addgene # 100834; 200 nL at 1 nl.s-1) in hippocampal CA1 using the following coordinates ...
-
bioRxiv - Neuroscience 2022Quote: ... a 1:1 mixture (100 nl total) of either retrograde AAV-hSyn-DIO-eGFP (Addgene) and AAV2-hSyn-mCherry (UNC vector core ...
-
bioRxiv - Neuroscience 2024Quote: ... a 1:1 mixture of AAV8-hSyn-DIO-EGFP (2.3 x 1013 CG/mL, Addgene) and AAV8-Flex-3mts-mScarlet (1.14 x 1013 CG/mL ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were transfected for lentiviral production in media containing 5 μg of each lentiviral packing plasmid (pMD2.G and psPAX2, Addgene: #12259, #12260, respectively), 10 μg of the scramble pLKO.1 or the NNT constructs (named here 1 and 2 ...
-
bioRxiv - Neuroscience 2020Quote: ... rv 5’-ATTTTAACTTGC-TATTTCTAGCTCTAAAACAACCATGTTCCG-TATTCAGATGCACCAGCCGGGAATCGAACC-3’) that were cloned with a single Gibson Assembly reaction in a pCFD6 (Addgene plasmid # 73915; RRID: Addgene_73915) vector [27] which was previously digested with BbsI restriction enzyme.
-
bioRxiv - Neuroscience 2021Quote: ... and four mice (control group) were stereotactically injected in the DR with AAV2/5-EF1α-DIO-WPRE-eYFP (Addgene viral prep 27056-AAV5) at a rate of 75 nl per min using surgical procedures (anesthesia ...
-
bioRxiv - Molecular Biology 2023Quote: The 5’ UTR of CCND2 mRNA was cloned into the pGL3-TK-5UTR-BsmBI-Luciferase reporter plasmid purchased from Addgene (https://www.addgene.org/114670/). The DNA fragment was amplified from cDNA prepared from HEK293T using primers with the extra 5’ end corresponding to the BsmbI cut sites in the plasmid ...
-
bioRxiv - Cell Biology 2024Quote: ... together with 10 µg psPAX2 lentivirus packaging plasmid and 5 µg lentivirus envelope plasmid (gifts from Didier Trono, Addgene #12260 and #12259, respectively) using 90 µL 1 mg/mL Polyethylenimine Hydrochloride (Polysciences ...
-
bioRxiv - Neuroscience 2024Quote: ... D) or AAV2/5-CAG-dLight1.1 (left hemisphere: one mouse, right hemisphere: four mice, 111067-AAV5, Addgene, Watertown, MA, USA, Fig. 1E, F) was injected into the dorsomedial striatum (DMS ...
-
bioRxiv - Cell Biology 2024Quote: Suitable gRNA target sites (5 ′ gRNA: GGAGGCTCTCGTGCCGGCTC, 3 ′ gRNA: GCTATAGGAAGCCACCGTTA) were identified by CRISPR optimal target finder 45 and cloned into pCFD5 (Addgene plasmid #73914; 46) via Gibson assembly (NEB).
-
bioRxiv - Neuroscience 2022Quote: ... then virus (AAV9-CaMKII-Cre, stock 2.1*1013 particles/nL, 1:1 dilution in PBS, Addgene) was pressure injected (NanoJect III ...
-
bioRxiv - Neuroscience 2021Quote: The lentiviral knockdown constructs were made using pLKO.1-Puro or pLKO.1-GFP plasmids (Addgene) (Zhuang et al ...
-
bioRxiv - Neuroscience 2024Quote: ... 3.26e14 GC-ml) diluted 1:1 with PBS or AAV5-CaMKII-GCaMP6f.WPRE.SV40 (Addgene, 2.3e13 GC-ml) diluted with PBS 1:2 into dorsal CA1 (−1.8 mm from Bregma ...
-
bioRxiv - Molecular Biology 2020Quote: ... and residues 1-133 (Addgene #138422) were PCR amplified from pcDNA4/TO-ORF24-3xFLAG (19 ...
-
bioRxiv - Developmental Biology 2021Quote: pLKO.1-puro plasmids (Addgene #8453) were cloned as previously described (78) ...