Labshake search
Citations for Addgene :
1301 - 1350 of 1474 citations for Human Procollagen Type III N Terminal Propeptide PIIINP ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: TALEN plasmids were constructed using the Platinum Gate TALEN Kit (Kit #1000000043, Addgene, Cambridge, MA) as previously described (Sakuma et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... sgRNA oligonucleotides targeting the human Pex5 locus (at 5’-GCTCGCCGGGCACTTCACCC-3’) were ligated into the BbsI site of pSpCas9(BB)-2A-GFP (PX458, Addgene Plasmid #48138) to generate pVD1629 ...
-
bioRxiv - Cancer Biology 2020Quote: The human CRISPR Brunello lentiviral prep was obtained from the Broad Institute Genetic Perturbation Platform and is also available from Addgene (73179-LV). The library contains 76,441 sgRNAs targeting 19,114 protein-coding genes and 1,000 non-targeting control sgRNAs ...
-
bioRxiv - Cancer Biology 2021Quote: ... KRT14 mouse and Human ShRNA sequence were cloned in the 3rd generation transfer plasmid pLKO.1 TRC cloning vector (Addgene cat # 10878) between unique AgeI and EcoRI restriction sites downstream of the U6 promoter ...
-
bioRxiv - Bioengineering 2021Quote: ... and Tspan12 were gifts from Jeremy Nathans and the human ACE2 clone (Shang et al., 2020) was obtained from Addgene (code 145033). Synthetic DNA fragments of engineered VH containing SARS-CoV-2 RBD (resi 333-527 ...
-
bioRxiv - Bioengineering 2020Quote: A pair of guide RNA targeting human EGFR was cloned into pSpCas9(BB)-2A-GFP (px458) plasmid vector (Addgene plasmid #48137) (Addgene, Cambridge, MA) following the depositor’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... solution carrying the jGCaMP7s gene under the human synapsin promoter (AAV1-hsyn-jGCaMP7s, ~1e12 GC/ml, 50 nl in each injection spot, Addgene plasmid #104487) was injected into the visual ...
-
bioRxiv - Biophysics 2021Quote: ... consisting of the human brain isoform B of fyn (confirmed by BLAST alignment) was a gift from Filippo Giancotti (Addgene plasmid # 16032)(Mariotti et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... a construct encoding a human codon-optimized Cas9 (hCas9) with an NLS at its C-terminus (a gift from George Church, Addgene plasmid #41815) (Mali et al. ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: We used a virus with the Gq-coupled designer receptor exclusively activated by a designer drug (DREADD) attached to the human synapsin promoter and the m-Cherry reporter (DR, AAV2 – hSyn – hM3Dq – mCherry; Addgene, Watertown, MA), as well as an empty vector control virus (Con ...
-
bioRxiv - Neuroscience 2022Quote: ... expressing mRuby2 and GCaMP6s under the human synapsin promoter (pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA) was purchased from Addgene (50942-AAV1). NPCs were differentiated to neural cells as described above and transduced by adding 1.44 μl virus solution per well in a μ-Slide 4 Well 5 days after cell seeding ...
-
bioRxiv - Biochemistry 2022Quote: ... For transient HER2 overexpression in HEK293 cells, the cells were transfected with a plasmid encoding human HER2 wildtype (Li et al., 2004)(Addgene plasmid #16257) the day before measurement with removal of the transfection reagent after 6 hours ...
-
bioRxiv - Systems Biology 2022Quote: ... The nuclear marker H2B-miRFP703 is a fusion of the human H2B clustered histone 11 (H2BC11) with the monomeric near-infrared fluorescent protein miRFP703 (Shcherbakova et al. 2016) (Addgene plasmid #80001). ERK-KTR-mRuby2 ...
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequence (sgRNA#3 CTCAACACCATCTTCATCCG) targeting the human NLK locus was cloned into pSpCas9 (BB)-2A-GFP (Addgene #481387 PX458). Wild-type iPSCs were transfected with gRNA and Cas9-expressing plasmid using an Amaxa Nucleofector 2b and successfully transfected cells were collected by FACS ...
-
bioRxiv - Neuroscience 2020Quote: ... pLenti c-Jun was created by cloning human c-Jun from PMIEG3-c-Jun (a gift from Alexander Dent (Addgene plasmid #40348)[50] using BAMHI and XHOI into pLenti-puro (a gift from Ie-Ming Shih (Addgene plasmid #39481 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Expression constructs needed to generate biotinylated anti-GFP nanobody for native purification from human cells are available from Addgene (#149336, #149334, #149333) (Pleiner et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... Raf1 gRNA sequence derived from a 3rd generation lentiviral gRNA plasmid targeting human Raf1 (A gift from John Doench, David Root, Addgene plasmid #76708). Specifically ...
-
bioRxiv - Biochemistry 2022Quote: ... Plasmid pX330 for expression of human-codon-optimized Streptococcus pyogenes (Sp) Cas9 and chimeric guide RNA were obtained from Addgene (Cambridge, MA). The seed sequence for the SpCas9 target site in the target gene was tcggtgcagaccacctcccgcgg (underline ...
-
bioRxiv - Cell Biology 2020Quote: Human GeCKOv2 CRISPR knockout pooled library and lenti-Cas9-Blast was a gift from Feng Zhang (Addgene # 1000000049, (Sanjana et al., 2014)) ...
-
bioRxiv - Biochemistry 2021Quote: DNA encoding human RTCB (Uniprot Q9Y3I0) was inserted using ligation-independent cloning into the UC Berkeley MacroLab 438B vector (Addgene plasmid #55219) and DDX1 (Uniprot Q92499) ...
-
bioRxiv - Biochemistry 2021Quote: DNA encoding amino acids Phe2-Asp101 of human CGI-99 was cloned into the UC Berkeley MacroLab 1B vector (Addgene plasmid # 29653). The fusion protein containing an N-terminal His6 tag and a TEV protease cleavage site was expressed in BL21 (DE3 ...
-
bioRxiv - Cancer Biology 2021Quote: Lentiviral vectors containing wild type and DNA-binding mutants of PRRX1 were generated by cloning cDNAs encoding full length or homeodomain deletions of the human PRRX1A sequence into the pInducer20 lentiviral plasmid (gift from Stephen Elledge, Addgene plasmid #44012). The DNA-binding mutants harbor individual deletions of the three α-helices (ΔH1 ...
-
bioRxiv - Microbiology 2020Quote: ... Guide sequences for IPPK and IPMK were obtained from the Human GeCKOv2 CRISPR knockout pooled libraries (a gift from Feng Zhang; Addgene #1000000048, #1000000049) [32] ...
-
bioRxiv - Immunology 2021Quote: ... The S106C mutant of human ASC PYD (aa1-106) was cloned into an in-house modified pET28-MBP-TEV vector (Addgene, plasmid #69929), in which N-terminal His6 tag was added for expression of proteins with a cleavable N-terminal His6-MBP-tag ...
-
Optimized RNA-targeting CRISPR/Cas13d technology outperforms shRNA in identifying essential circRNAsbioRxiv - Molecular Biology 2020Quote: The lentiviral gRNA and pre-gRNA expressing backbones were constructed by cloning the human U6 promoter and CasRx gRNA or pre-gRNA scaffold (Addgene #109053, #109054) into lentiGuide-Puro (Addgene ...
-
bioRxiv - Molecular Biology 2021Quote: ... A pX330 plasmid for expression of the human codon-optimized Streptococcus pyogenes (Sp) Cas9 and chimeric guide RNA was obtained from Addgene (Cambridge, MA). The seed sequences for the SpCas9 target site in target genes are shown in Table S2 ...
-
bioRxiv - Neuroscience 2023Quote: ... proteins were generated by sub cloning HA-tagged human TRIM71 and its mutant variants sequences from pMXS-hs-3xHA-TRIM71 (Addgene, no. 52717), pMXs-hs-3xHA-deltaRING-TRIM71 (Addgene ...
-
bioRxiv - Immunology 2023Quote: ... KO N/TERT keratinocytes were made and described in detail previously 27.MAP3K20 (ZAKα) KO human primary keratinocytes were generated using lentiviral Cas9 and guide RNA plasmid (LentiCRISPR-V2, Addgene plasmid #52961) using the following guides ...
-
bioRxiv - Genomics 2023Quote: ... The oligomer sequence was obtained from the data and the surrounding sequence was retrieved from the human STAP-seq screening vector sequence (Addgene ID: 125150). Both basepair level and TSS-level prediction and experimental measurements were compared ...
-
bioRxiv - Neuroscience 2023Quote: ... A 10-sgRNA-per-gene CRISPR/Cas9 deletion library (Human CRISPR Knockout library was a gift from Michael Bassik (Addgene # 101926-101934)) was infected into Cas9-expressing U937 cells as described16 ...
-
bioRxiv - Cancer Biology 2024Quote: ... the Human GeCKOv2 CRISPR Knockout Pooled Library (A+B) in the lentiGuide-Puro vector backbone (gift from Feng Zhang; Addgene Plasmid # 1000000048) was amplified and purified as directed by Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... the murine shRNA hairpins pLKO.1-shCdkn2a #1 (TRCN0000077816) and #2 (TRCN0000362595) and the human and murine pLKO.1-shGFP control (Addgene, cat#30323) vectors were packaged using the ViraPower Kit (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: Donor plasmid encoding homology arms and linker-mEGFP sequence for C-terminus tagging of human NPM1 was designed by the Allen Institute for Cell Science and obtained from Addgene (AICSDP-50). The plasmid encoding NPM1-mEGFP was a gift from the Allen Institute for Cell Science (Addgene plasmid # 109122) ...
-
bioRxiv - Cell Biology 2022Quote: ... were constructed by cloning the open reading frame (ORF) of human IRF1 or cMYC into a modified pLX303 vector (Addgene plasmid 25897). cDNAs encoding IRF1-SBDmut ...
-
bioRxiv - Genetics 2022Quote: ... in vitro transcription assays for human POU6F2 was performed using a reporter plasmid that encodes DsRed under a Hes5 promoter (Addgene, Cat# 26868). For POU6F2 expression vectors ...
-
bioRxiv - Neuroscience 2023Quote: ... A human Sirt3-RFP driven by the CaMKII promoter was constructed through PCR of the human Sirt3 sequence from Sirt3-FLAG (Addgene plasmid 13814)5 into the BamHI and AgeI sites of CaMKII-MICU3-RFP plasmid6 resulting in the linker sequence RPVVA joining Sirt3 and RFP sequences.
-
bioRxiv - Bioengineering 2023Quote: ... iPSCs were transfected with LSD-dCas9-BFP-KRAB and TALENS targeting the human CLYBL safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using transfection reagent ...
-
bioRxiv - Genetics 2023Quote: ... FlpOM was generated by introducing the human b-globin intron from CreM into a codon optimized Flp (Raymond and Soriano, 2007; Addgene plasmid # 13792), interrupting the coding sequence between amino acids 159 and 160 ...
-
bioRxiv - Cell Biology 2023Quote: ... MCF-7 or HeLa single cell colonies were selected from cells transduced with the following sequences targeting human genes cloned into lentiCRISPR v2 (Addgene no. 52961):
-
bioRxiv - Neuroscience 2024Quote: ... iPSCs were transfected with pC13N-dCas9-BFP-KRAB and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA In-Stem (VitaScientific) ...
-
bioRxiv - Microbiology 2024Quote: ... sequence targeting the third exon of the human L1CAM gene (5’-GAGTAGCCGATAGTGACCTG-3’) was designed and cloned into the pKLV2-U6gRNA(BbsI)-PGKpuro2ABFP vector (Addgene plasmid #67974). For the production of lentiviral particles carrying the CRISPR/Cas9 components ...
-
bioRxiv - Immunology 2024Quote: ... pcDNA3-sACE2(WT)-8his encoding soluble human ACE2 (UniProt Q9BYF1, residues 1-732) was a gift from Erik Procko (Addgene plasmid #149268) and was expressed and purified as described above for the other recombinant proteins.
-
bioRxiv - Neuroscience 2024Quote: ... Then the ArcLight targeting constructs were transferred into a Cre-dependent expression cassette of AAV-DIO vector (Double-floxed Inverted Orientation with LoxP and Lox2272) with the human synapsin I promoter (the backbone is the same as the Addgene #50457 plasmid) for making Adeno-associated viral (AAV ...
-
bioRxiv - Bioengineering 2024Quote: ... 8 × 106 reporter cells were transduced in 6-well format with 1 ml Human Brunello CRISPR knockout pooled library (Addgene #73178 31) in the presence of 10 μg/ml polybrene (Merck Millipore) ...
-
bioRxiv - Biochemistry 2024Quote: The plasmid for bacterial expression of full-length human His-3C-HOIL-1 (pOPINB-HOIL-1 full-length) is available from Addgene (Plasmid #193858) (29) ...
-
bioRxiv - Neuroscience 2020Quote: The TALEN kit used for TALE assembly was a gift from Keith Joung (Addgene kit # 1000000017). DNA fragments encoding ROSA TALEN repeat arrays were cloned into plasmid pJDS71 ...
-
bioRxiv - Biochemistry 2024Quote: ... roseus were assembled using the GoldenBraid 2.0 kit (Sarrion-Perdigones et al., 2013) (Addgene kit # 11000000076) (Fig ...
-
bioRxiv - Plant Biology 2020Quote: ... from Sylvestre Marillonnet (Addgene kit # 1000000044). Specific parts (target gRNA or siRNA sequence ...
-
bioRxiv - Synthetic Biology 2022Quote: The MoClo Toolkit (Addgene Kit #1000000044), MoClo Plant Parts Kit (Addgene Kit #1000000047) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... GreenGate Cloning System (Addgene Kit #1000000036) and amilCP_Orange chromoprotein vector (Addgene Plasmid #117850 ...