Labshake search
Citations for Addgene :
1301 - 1350 of 1668 citations for 8 8 dimethylpyrano 2 3 h chromen 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... Rev 5’-AAAGCTAGCTCAGGTTGCCTGGTCCAG-3’ and cloned into the pCI H2B-RFP vector (Addgene plasmid #92398). For CRISPR/Cas9 targeting ...
-
bioRxiv - Neuroscience 2022Quote: ... The original CIRTs-6: B-defensin 3-TBP6.7-YTHDF2 plasmid (# 132544) was purchased from Addgene and the YTHDF2 domain was PCR amplified and cloned into the AgeI and NheI sites ...
-
bioRxiv - Neuroscience 2023Quote: ... The amplicons were inserted into the pCMV-Tag-2b or pGEX-5X-3 vector (Addgene). Spastin mutants were generated using the Quickchange Kit (Agilent ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5′-GGCTGCCGTAGCGCGACGTG-3′) were cloned into pLentiCRISPRv2 (Addgene-52961). An NT gRNA (5′-GTATTACTGATATTGGTGGG-3′ ...
-
bioRxiv - Neuroscience 2023Quote: ... HEK293T cells were co-transfected with 3 plasmids: pAd-DELTA F6 (plasmid No. 112867; Addgene), serotype plasmid AAV PHP.eB ...
-
bioRxiv - Cancer Biology 2023Quote: ... The ITGB3 sequence (pcDNA3.1-beta-3 was a gift from Timothy Springer; Addgene plasmid # 27289) was subcloned into pLenti6.3/TO/V5-Blasti (A11144 ...
-
bioRxiv - Cell Biology 2023Quote: ... the gRNA sequence 5’-AATGAGGCCTTGGAACTCA-3 was cloned into the Px330 vector (Addgene plasmid #42230) and transfected into cells using Lipofectamine Stem according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2023Quote: ... and 3’ extension oligos were cloned into the BsaI-digested pU6-pegRNA-GG- (Addgene #132777), pU6-tevopreQ1-GG- (Addgene #174038 ...
-
bioRxiv - Plant Biology 2023Quote: ... and 3′ UTR and terminator sequences from Agrobacterium tumefaciens nopaline synthase (AtuNOST) (pICH41421, Addgene #50339). As a batch calibrator ...
-
bioRxiv - Cancer Biology 2023Quote: ... SgRNA targeting EGFR (5’-CGATCTCCACATCCTGCCGG-3’) was cloned into the lentiGuide-puro vector (Addgene, USA) (18) ...
-
bioRxiv - Immunology 2023Quote: ... and a non-targeting control (5’-CACCGGTATAATACACCGCGCTAC-3’) were cloned into the lentiCRISPRv2 vector (Addgene). The gRNA construct was then co-transfected with two packaging plasmids (pMD2.G and pSPAX2 ...
-
bioRxiv - Neuroscience 2023Quote: Unilateral stereotaxic injections of AAV5-CaMKIIα-EGFP (Addgene #50469; virus titer ≥ 3×10¹² vg/mL) and AAV5-hSyn-DIO-hM4D(Gi)-mCherry (Addgene #44362 ...
-
bioRxiv - Cell Biology 2020Quote: ... and transfected at 4-6 h with a plasmid encoding HA-Separase (pCS2+HA-hSeparase was a gift from Marc Kirschner, Addgene plasmid # 33018), Plk1TD expression was induced 8-10 h after shake off and cells were fixed at 28 h to analyze distancing or at 32 h (20 h of S phase arrest ...
-
bioRxiv - Cell Biology 2019Quote: ... for 24 h and transfected with DELE1 truncated constructs and/or plasmid mito7-mRuby (a gift from Michael Davidson, Addgene plasmid # 55874) as indicated ...
-
bioRxiv - Biophysics 2022Quote: ... lentivirus was generated using pcDNA/TO/GFP H-Ras V12 (gift of Yasuyuki Fujita)[43] and pLenti CMV TetR Blast (Addgene plasmid 17492), and cells were selected based on fluorescent expression.
-
bioRxiv - Molecular Biology 2023Quote: ... values were converted into copy numbers by measuring against a standard curve of the AAV transfer plasmid or the Ai9 plasmid (a gift from H. Zeng Addgene plasmid # 22799). The AAV genome copy number was divided by the number of nuclei to normalize for tissue input.
-
bioRxiv - Cancer Biology 2019Quote: The RL cell-line (ATCC CRL-2261) was modified by electroporation of one of two unique gRNA sequences in the pSpCas9(BB)-2A-GFP vector (Addgene plasmid #48138, gift from Feng Zhang)17 with a single-stranded oligonucleotide donor template ...
-
bioRxiv - Neuroscience 2020Quote: ... the target sequence (5’-GGGTGAAGATCCTGTTCAATA-3’) was shuttled to the pLKO.1-Hygromycin vector (Addgene, #24150). For human astrocytes ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Optimal gRNA (5’-CCTACGAACTCCGGTGTCAG-3’) was cloned into the pSPCas9(BB)-2A-GFP plasmid (Addgene #48138) as described previously by Ran et al.,21 and introduced into ciPTEC using PolyPlus JetPrime ...
-
bioRxiv - Neuroscience 2022Quote: ... The loops were shuttled into pCSF107mT-GATEWAY-3’-3HA (gift from Todd Stukenberg, Addgene plasmid # 67616) using Gateway LR clonase ...
-
bioRxiv - Immunology 2020Quote: ... Guide sequences (listed in Supplementary Table 3) were cloned into the lentiCRISPR v2 plasmid (Addgene #52961) and lentiviral particles were generated in 293T cells (ATCC ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse primer NT: 5’-CGGGATCCCTATTGAGTTCTTTTGTGCTC-3’) and cloned into the mApple-C1 vector (Addgene plasmid # 54631) using the XhoI and BamHI restriction sites ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Optimal gRNA (5’-GTCGTAAAGCTGGAGAACGG-3’) was cloned into the pSPCas9(BB)-2A-GFP plasmid (Addgene #48138) as described previously by Ran et al ...
-
bioRxiv - Genomics 2021Quote: ... 5 µg of sgRNA plasmid library was co-transfected with 3 µg of psPAX (Addgene, 12260) and 1 µg of pMD2.G (Addgene ...
-
bioRxiv - Genomics 2021Quote: We used PCR to add V5 epitope tags to the 3’ end of FoxA1 (Addgene #120438) and Hnf4a (Addgene #120450 ...
-
bioRxiv - Cancer Biology 2022Quote: ... PC-3 HRE luciferase cells were generated by co-transfection of 3xHRE-luciferase construct (Addgene 26371) with a puromycin-resistant construct ...
-
bioRxiv - Neuroscience 2022Quote: [3] ie1: An enhancer/promoter from pGL3-IE1 (a gift from Zach Adelman, Addgene ID #52894) (Anderson et al. ...
-
Improving the efficacy and accessibility of intracranial viral vector delivery in non-human primatesbioRxiv - Neuroscience 2022Quote: ... Subjects MTL1-3 were infused with two retrograde viruses (gifted from Edward Boyden & Karel Svoboda; Addgene viral preps #59170-AAVrg & #29017-AAVrg ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV.CamKII(1.3).eYFP.WPRE.hGH was a gift from Karl Deisseroth (Addgene plasmid# 105622; http://n2t.net/addgene:105622; RRID:Addgene_105622).
-
bioRxiv - Cell Biology 2024Quote: ... or human Mon1b (5’-GATGTGCAGATGGAGGTCGG-3’) were cloned into pSpCas9(BB)-2A-Puro (PX459) (Addgene #48139). The donor constructs used for homologous recombination were generated by cloning into the pUC19 vector with two ∼600-800-nucleotide fragments of genomic DNA upstream and downstream of the start codon of human USP8 ...
-
bioRxiv - Biochemistry 2024Quote: ... human PLD3 sgRNA (5′-3′) was cloned into pSpCa9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988) as described (Ran et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... The DNMT1-targeting sgRNA (5′-GGCGGTACGCGCCGGCATCT –3′) was cloned into pX330 hSpCas9 expressing vector (Addgene #42230) and verified by sequencing.
-
bioRxiv - Cell Biology 2023Quote: ... and (3) GFP1-10 from pFA6a-link-yGFP1-10-CaURA3MX (Addgene 86419; (Smoyer et al., 2016)) and subsequent cloning into the XhoI/NotI sites of pRS304 mito-DsRed.
-
bioRxiv - Molecular Biology 2023Quote: ... compact BFP-tagged CRISPRi sublibraries containing 5 sgRNAs per TSS (Addgene, Cat#83971-3 and #83975) expressed in the pCRISPRi-v2 expression vector (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: shRNA sequence targeting TAL1 3’UTR (CATAACCACTGAAGGGAAT) was cloned to Tet-pLKO-puro vector (Addgene #8453). For lentivirus production ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNAs corresponding to 3’ to the region of interest was cloned in pDecko-mCherry (Addgene, #78534). The puromycin resistance cassette in pLentiCRISPRv2 was replaced by a GFP gene using standard cloning techniques ...
-
bioRxiv - Developmental Biology 2023Quote: ... The three fragments were subcloned into pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3 (Addgene #62957) by replacing T2A-Gal4 with T2A-GAL4DBD ...
-
bioRxiv - Developmental Biology 2023Quote: ... The three fragments were subcloned into pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3 (Addgene #62957) by replacing T2A-Gal4 with T2A-VP16 ...
-
bioRxiv - Cell Biology 2023Quote: ... Both pie-1p and pie-1 3’UTR PCR products were amplified using pPK605 plasmid (Addgene) as the template.
-
bioRxiv - Synthetic Biology 2023Quote: ... pNO286-3 (a gift from Jeffrey Tabor, Addgene plasmid # 107746; http://n2t.net/addgene:107746; RRID:Addgene 107746) [32] ...
-
bioRxiv - Molecular Biology 2023Quote: ... with 3 million K562 cells and 10 µg of pCMV-PE2-tagRFP-BleoR (Addgene no. 192508) per individual electroporation (Day 0) ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.3 μl of AAV2/9-CAG-ChR2-mCherry (3 × 1012 genomic copies per mL, Addgene, 100054) or AAV2/9-CAG-mCherry (2.85 × 1012 genomic copies per mL ...
-
bioRxiv - Cancer Biology 2023Quote: ... 293FT cells were co-transfected using (per condition) 3 µg of pLKO.GFP transfer plasmid (Addgene, #30323) containing the shRNA (sequences in Supplementary Table S6) ...
-
bioRxiv - Neuroscience 2024Quote: USP14_Reverse: 5’ AAACCCAATGGTATTCAAGGCTCACC 3’ were cloned into pSpCas9(BB)-2A-Puro vector (PX459, 62988, Addgene, USA) using FastDigest BpiI (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... Co-expression of GCaMP6s and mRuby2 in neocortical and hippocampal neurons was achieved by injecting pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6s one week before imaging (Fig. 1A; Addgene, catalog # 50942-AAV1; 1.2×1013 GC/mL). Animals were anesthetized using hypothermia ...
-
bioRxiv - Cancer Biology 2021Quote: Galectin-3 cDNA was subcloned into the pMIG-GFP retroviral expression vector (plasmid #9044, AddGene, Cambridge, MA). Stably transduced hGalectin-3 expressing OP9 cells were generated by infecting cells with retroviral particles and FACS sorting of GFP expressing (positively transduced ...
-
bioRxiv - Molecular Biology 2021Quote: ... pYM-N2339 and pFA6a-hphMX-(3×FLAG)-TEV-ProtA (gift from Michael Nick Boddy, Addgene plasmid # 52692).
-
bioRxiv - Molecular Biology 2020Quote: ... mEmerald-ER-3 was a gift from Michael Davidson (Addgene plasmid # 54082; http://n2t.net/addgene:54082; RRID:Addgene_54082). Cells were seeded on high precision coverslips (Marienfeld ...
-
bioRxiv - Molecular Biology 2019Quote: ... mNT-sgRNA-R: 5’-AAACCGCGGAGCCGAATACCTCGC-3’) were cloned into the lenti-sgRNA(MS2)-zeomycin backbone (Addgene #61427) using BsmBI ...
-
bioRxiv - Neuroscience 2019Quote: ... oligonucleotide pairs (Supplementary Table 3) were annealed and cloned into BbsI-digested pCFD3-dU6-3gRNA (Addgene #49410), as described59 ...