Labshake search
Citations for Addgene :
1301 - 1350 of 3325 citations for 6H 1 3 Thiazin 6 one 2 ethoxy 4 hydroxy 5 nitro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... 3 × 106 HEK293T cells were transfected using GenJet transfection reagent (Signagen) with 7.5 µg psPax2 (Addgene #12260), 5 µg VSV-G (pMD2.G ...
-
bioRxiv - Neuroscience 2020Quote: A Nectin-3 overexpression construct was created by modifying a pCag-iCre expression vector (Addgene plasmid # 89573). Nectin-3 alpha was PCR amplified (KOD hot start DNA polymerase ...
-
bioRxiv - Molecular Biology 2019Quote: ... table 3 for sgRNA sequences) together with an expression vector encoding Cas9-2A-GFP (pX458; Addgene #48138) using lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Cell Biology 2019Quote: ... and 3’UTR sequence of histone H1 sequentially into the backbone vector pFGL822 (Addgene #58225, Basta resistance); pCytoplasm GFP was constructed by inserting PCR fragments of histone H3 promoter and the GFP ORF sequentially into the backbone vector pFGL1010 (Addgene #119081 ...
-
bioRxiv - Immunology 2021Quote: ... HEK 293T cells were reverse-transfected with 3 plasmids: psPAX2 (a gift from Didier Trono, Addgene #12260), pEGFP-Vpr (obtained through the NIH HIV Reagent Program ...
-
bioRxiv - Molecular Biology 2022Quote: pET21b-Caspase-3-His6 and pET21b-Caspase-7-His6 were gifts from Clay Clark (Addgene plasmid #90087) and Guy Salvesen (Addgene plasmid #11825) ...
-
bioRxiv - Microbiology 2022Quote: ... RSAD2 forward 5’ caccgAGTGGTAATTGACGCTGGTG 3’ and reverse 5’ aaacCACCAGCGTCAATTACCACTc 3’) were designed using CHOPCHOP web tool (https://chopchop.cbu.uib.no/) and cloned into pLentiCRISPR v2 vector (Addgene) as described [92 ...
-
bioRxiv - Microbiology 2024Quote: The full-length HIV vectors NL4-3 ΔEnv EGFP (HIV Reagent Program) and HIVGKO (Addgene plasmid #112234) were produced in HEK293T cells along with the VSV-G (Addgene plasmid # 8454 ...
-
bioRxiv - Genetics 2023Quote: ... pCFD4-U6:1_U6:3 was a gift from Simon Bullock (Addgene plasmid #49411; http://n2t.net/addgene:49411; RRID:Addgene_49411). His3.3A reference sequence ...
-
bioRxiv - Genomics 2023Quote: ... vectors were co-transfected with 3 µg of pCas9_GFP (a gift from Kiran Musunuru; Addgene plasmid #44719; http://n2t.net/addgene:44719; RRID:Addgene_44719) (Ding et al ...
-
bioRxiv - Neuroscience 2023Quote: Cortical neurons control and VPS50 mKO were co-infected at 3 DIV with GCaMP7f (Addgene Cat#104488). At 10 DIV ...
-
bioRxiv - Neuroscience 2023Quote: ... or a control virus (AAV2-hSyn-DIO-EGFP, 100 µL at titer ≥ 3×10¹² vg/mL, Addgene). A subset of the optogenetic L6-CT experiments was done in Ntsr1-Cre-ChR2-EYFP mice ...
-
bioRxiv - Neuroscience 2023Quote: ... Virus expressing gCaMP7f (AAV1-syn-jGCaMP7f-WPRE, stock concentration 3 x 1013 vg/mL, Addgene, 104488-AAV1)53 ...
-
bioRxiv - Cancer Biology 2024Quote: ... For co-transfection of NT-3 cells with siRNAs and RINS1 plasmid (gift from Dmytro Yushchenko, Addgene plasmid # 107290 ...
-
bioRxiv - Immunology 2024Quote: ... pEMB52-14-3-3_1_247 (γ) was a gift from the Michael J Fox Foundation MJFF (Addgene #40541); pcDNA-HA-14-3-3β (Addgene #13270) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and then merged it into the 3’UTR of eGFP expression cascade in LPutopia-7 (Addgene #199212) plasmid ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 µg psPAX2 (psPAX2 was a gift from Didier Trono; Addgene plasmid # 12260) and 2 µg VSVg were mixed with 30 µL X-tremeGene9 transfection reagent (Sigma-Aldrich ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The module 5 was taken from the pAJM.847 plasmid in (41) (Addgene #108524 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a WPRE (cloned from pLenti CMV GFP Puro (658-5) (Addgene #17448)) all flanked by epigenetic insulator sequences by repetitive restriction digests (KflI-EcoRI ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 μg pMDLg/RRE and 2.5 μg pRSV-REV (Addgene #14888, #12251, #12253) using calcium phosphate ...
-
bioRxiv - Cell Biology 2022Quote: ... The hCRISPRi-v2 compact library (5 sgRNAs per gene, Addgene pooled library #83969) was transduced in duplicate into 330 million K562-CRISPRi-Tet-ON-((MICU1)-GFP1-10)-(tet-RFP-P2A-OMP25-GFP11 ...
-
bioRxiv - Cell Biology 2023Quote: ... 5*10^10 genomic copies of commercially produced AAV8-TBG-Cre (Addgene #107787) or control AAV8-TBG-GFP (Addgene #105535 ...
-
bioRxiv - Biochemistry 2023Quote: Guide RNA targeting PARP1 (5’- CCACCTCAACGTCAGGGTGC) was cloned into LentiCRISPRv2 vector (Addgene, 52961). Lentivirus carrying CRISPR/Cas9-PARP1 guide was transduced to HCT116 in the presence of 8 μg/ml polybrene ...
-
bioRxiv - Biochemistry 2023Quote: Guide RNA targeting ATP6V1B2 (5’- AAACTTACCATCATTAGGCA) was cloned into pX330 vector (Addgene, #42230). HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tacatgtatacagatttagccacgatatatgaacgcgctgggcgagtggaagggagaaacggctcgattactcaaatccctattctGacAatgcctaatA atggtaagttttggtatttggattataacacacctaatcattttaaagagagagaagacccatctaccttttcgagttgaagttattttgagaacacatc using TransIT-LT (Mirus) ...
-
bioRxiv - Biochemistry 2023Quote: Guide RNA targeting PARP1 (5’- AAACATGTAGCCTGTCTGGA) was cloned into pX330 vector (Addgene, #42230). HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccagacaggctacatgtttggtaaagggatcta tttcactgatatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatcctgttgggagaagttgcccttggaaacatgtg agt for A898T mutation and 5’- tggcactcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccag acaggctacatgtttggtaaaggaatctgtttcgctgacatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatc ctgttgggagaagttgcccttggaaacat for Y896C mutation using TransIT-LT (Mirus) ...
-
bioRxiv - Neuroscience 2023Quote: ... mice were injected with 0.5 µl of AAV2/5-CaMKIIα-GCaMP6f (Addgene, #100834) into the vH (AP -3.28 mm ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 μg of VSV-G envelope expressing plasmid pMD2.G (Addgene #12259) were co-transfected into HEK293T cells using calcium phosphate transfection ...
-
bioRxiv - Molecular Biology 2023Quote: ... to remove the neomycin selection cassette or both 5 μg pFlpO (Addgene #13792) and 5 µg of pCrePac(Taniguchi ...
-
bioRxiv - Neuroscience 2023Quote: The following viruses were used: AAV2/5-ef1alpha-FLEX-taCasp3-TEVp (Addgene, 45580) and AAV2/1-CAG-FLEX-EGFP-WPRE (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... 500 ng purified oligo were mixed with 5 μg lentiCRISPR v2 (Addgene #52961) backbone ...
-
Structures of native SV2A reveal the binding mode for tetanus neurotoxin and anti-epileptic racetamsbioRxiv - Biochemistry 2024Quote: ... Nb1-5 were PCR amplified and subcloned into the vector pBXNPHM365 (Addgene #11099) and fused with a C-terminal (TSII-tagged ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.25 μL of F-ABM lentiviral mix (1:1:1:1 of Addgene plasmids 27150 ...
-
bioRxiv - Neuroscience 2021Quote: ... pAAV5-hSyn-dLigh1.2 (titer ≥ 4×1012 vg/ml) was a gift from Lin Tian (Addgene viral prep #111068-AAV5 ...
-
bioRxiv - Neuroscience 2019Quote: ... oligonucleotide pairs (Supplementary Table 4) were used for PCR and inserted into pCFD5 (Addgene #73914) via Gibson Assembly ...
-
bioRxiv - Neuroscience 2020Quote: ... DIV 4 neurons were transfected with pGP-CMV-GCaMP6f (a gift from Douglas Kim, Addgene plasmid # 40755 ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgFIGNL1#4: CCTATACCCAAGCAAGATGG) were cloned into lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid #52961) in a single-step digestion-ligation reaction (2 hours (h ...
-
bioRxiv - Neuroscience 2022Quote: [4] DsRed from pBac-DsRed-ORCO_9kbProm-QF2 (a gift from Christopher Potter, Addgene ID #104877) (Riabinina et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 x 105 cells from the previous transfection were transfected with pCMV-PEmax (Addgene: 174820)11 (800 ng ...
-
bioRxiv - Neuroscience 2024Quote: ... oligonucleotide pairs (Supplemental Table 4) were used for PCR and inserted into pCFD5 (Addgene #73914) via Gibson Assembly ...
-
bioRxiv - Neuroscience 2022Quote: ... one group of animals (n=6) received a bilateral injection of a virus driving expression of the calcium indicator GCaMP7s (AAV9-hSyn-GCaMP7s-WPRE; Addgene; 300nL per side) targeting the CA1v at the following stereotaxic coordinates ...
-
bioRxiv - Cell Biology 2020Quote: ... mCherry-Mito-7 and mCherry-ER-3 were kindly provided by Michael Davidson (Addgene plasmids #55102 and #55041).
-
bioRxiv - Cell Biology 2020Quote: ... a fragment containing the 3×Flag-nls-cas9-nls coding sequence isolated from pBS-Hsp70-cas9 (Addgene, #46294) with same enzymes was inserted ...
-
bioRxiv - Genetics 2021Quote: ... sgRNAs (single gRNA) expressing plasmid was generated using the pCFD3-dU6:3 gRNA vector (Plasmid ID: #49410, Addgene) as described in (Port et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... The injection mix was prepared in MilliQ H2O and contained 60 ng/mL Peft-3::Cas9 (Addgene #46168), 45 ng/mL each sgRNA plasmid ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-GGG GGG GGC GGA ATT CTC AGT CTA TCT TTT CTT TCT GGA CCA GTC TGG GAG C-3’ and pmScarlet-C1 (gift from Dorus Gadella; Addgene plasmid # 85042; http://n2t.net/addgene:85042; RRID:Addgene_85042) and GFP-TM(SAC1 ...
-
bioRxiv - Genetics 2019Quote: ... Cells were co-transfected with luciferase reporter plasmids (Figure 2A) or a positive control (pAP1-3, Addgene 71258) and a renilla normalisation control (pGL4.74 ...
-
bioRxiv - Cell Biology 2019Quote: ... pCIG3 (pCMV-IRES-GFP version 3) was a gift from Felicia Goodrum (Addgene plasmid # 78264; http://n2t.net/addgene:78264; RRID:Addgene_78264). The fibroblasts were incubated at 37°C with 5% CO2 and 5% O2 ...
-
bioRxiv - Cell Biology 2021Quote: ... (generated by making 3 point mutations, I102N, H158E, and Y189A in the Addgene mEos2 plasmid #20341 [http://n2t.net/addgene:20341; RRID:Addgene_20341] ...
-
bioRxiv - Cell Biology 2021Quote: ... (generated by making 3 point mutations, I102N, H158E, and Y189A in the Addgene mEos2 plasmid #20341 [http://n2t.net/addgene:20341; RRID:Addgene_20341] ...
-
bioRxiv - Cell Biology 2020Quote: ... pDD162 (Peft-3::Cas9 + Empty sgRNA) was a gift from Bob Goldstein (Addgene plasmid # 47549; http://n2t.net/addgene:47549; RRID:Addgene_47549) (Dickinson et al ...