Labshake search
Citations for Addgene :
1251 - 1300 of 1462 citations for Recombinant Human CD96 Protein His Avi tagged Biotinylated since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... Cells were co-transfected with plasmids encoding a mixture of viral packaging proteins VSV-G (12259, Addgene), viral backbone psPAX2 plasimd (12260 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and the vectors encoding for the packaging proteins (pCMVR8.74; gift from Didier Trono (Addgene plasmid # 22036; http://n2t.net/addgene:22036; RRID:Addgene_22036)) and VSV-G envelope (pMD2.G ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids encoding HCoV-229E and SARS-CoV-2 N proteins were obtained from Addgene (#151912 and #141391). C-terminally FLAG-tagged 229E N and SARS-CoV-2 N constructs were cloned into pcDNA3.1 using specific primer sequences (Supplementary Table S1).
-
bioRxiv - Bioengineering 2023Quote: ... ssDNA binding protein and peptide sequences were synthesized and assembled into an AIO plasmid modified from Addgene plasmid #42230 by golden gate cloning ...
-
bioRxiv - Immunology 2023Quote: ... 0.5 µg of a plasmid encoding the vesicular stomatitis virus G protein (pMD2.G, Addgene plasmid #12259), 0.25 µg of a plasmid encoding for the transactivating protein Rev (pRSV-Rev ...
-
bioRxiv - Microbiology 2024Quote: ... envelope protein-expressing vector pCMV-VSVG (38) and the transfer vectors pEF1a-CAS9-2A-Blasticidin (#52962, Addgene) or pU6-gRNA-PGK-Puro-2A-BFP encoding CRISPR-Cas9 guide RNAs (gRNAs ...
-
bioRxiv - Molecular Biology 2023Quote: ... fragments containing promoter and fusion protein segments were digested and cloned into the pKHR4 vector (Addgene #74592) using SpeI (NEB #R3133 ...
-
bioRxiv - Genetics 2024Quote: ... and blue fluorescent protein (tagBFP) with a KRAB domain at the C-terminus (Addgene 167981; Figure 1A)14 ...
-
bioRxiv - Biochemistry 2024Quote: ... The plasmid used to produce the nanodiscs scaffold protein (MSP1E3D1) was purchased from Addgene (Cambridge, MA, USA).
-
bioRxiv - Biochemistry 2024Quote: ... bearing the gene for membrane scaffold protein expression was a gift from Stephen Sligar (Addgene plasmid # 20066) and was expressed as described before43 ...
-
bioRxiv - Developmental Biology 2024Quote: ... mEos3.2 and green-to-red photoconvertible protein (a gift from Michael Davidson & Tao Xu (Addgene plasmid 54525) was coupled to Histone 2B (H2B ...
-
bioRxiv - Cell Biology 2021Quote: ... .The KIF1C motor domain was replaced with full length human KIF1C fused to mCherry from pKIF1C-mCherry (available from Addgene 130978 (Theisen et al., 2012)) using NheI and BsrGI ...
-
bioRxiv - Microbiology 2020Quote: ... a total of 300 million Huh7.5.1-Cas9 cells were then separately transduced with the lentiviral gRNA sublibraries A and B of the human GeCKO v2 library (Addgene #1000000049, gift from Feng Zhang) at a multiplicity of infection (MOI ...
-
bioRxiv - Biochemistry 2021Quote: The RAS binding domain of C-RAF kinase (RAF-RBD) (Brtva et al., 1995) and full-length human RASSF5 from the RAS clone collection were obtained from Addgene (Raf1-RBD: #13338, RASSF5: #70545). The RAS clone collection was a gift from Dominic Esposito (Addgene kit 1000000070) ...
-
bioRxiv - Cell Biology 2023Quote: The sequences encoding STIM1 and RspA-NFAST were amplified by PCR from respectively the human STIM1-YFP plasmid (Addgene #19754, a gift from A. Rao) and the pAG573 FRB-RspA(N)-IRES-mTurquoise214 plasmid ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... GFP as non-human target (NHT) control (5’-GGAGCGCACCATCTTCTTCA-3’, 5’-GCCACAAGTTCAGCGTGTC-3’, and 5’-GGGCGAGGAGCTGTTCACCG-3’) cloned into pLentiCRISPRv2 (Addgene, 52961, deposited by Feng Zhang). To generate lentiviral particles ...
-
bioRxiv - Biophysics 2024Quote: ... the DNA fragments of human TDP-43 obtained from the TDP-43 expression plasmid as previously reported 45 and G3BP1 from Addgene (Clone#129339, Watertown, MA, USA) were inserted into the HindIII and BamHI sites of pcDNA-SNR (pTDP43-SNR and pG3BP1-SNR ...
-
bioRxiv - Cell Biology 2022Quote: 6.0 × 10^6 BJAB clone B2 cells expressing both Cas9 and ERAAP dsRed were transduced with lentivirus of human GeCKO v2 library (Addgene, #1000000049, gift from Feng Zhang) at an MOI of 0.4 using spin-infection (1,000 g for 2 h at 33 °C) ...
-
bioRxiv - Systems Biology 2022Quote: ... a total of 240 million A549-Cas9 cells were transduced with the lentivirus of the human GeCKO v2 library (Addgene #1000000049, gift from Feng Zhang) (48 ...
-
bioRxiv - Cancer Biology 2021Quote: ... For expression of the Cas9 protein the lentiCas9-Blast expression vector was used (Addgene plasmid #59262; http://n2t.net/addgene:52962; RRID:Addgene_52962) [80] ...
-
bioRxiv - Cancer Biology 2020Quote: ... A plasmid expressing Green Fluorescent Protein (GFP) (pLJM1-EGFP was a gift from David Sabatini (Addgene plasmid # 19319; http://n2t.net/addgene:19319; RRID:Addgene_19319), [125]) ...
-
bioRxiv - Microbiology 2022Quote: ... 1µg of lentiviral vector bearing green fluorescent protein (GFP) (PLV-eGFP) (gift from Pantelis Tsoulfas, Addgene plasmid # 36083) 90 using Jetprime transfection reagent (Polyplus ...
-
bioRxiv - Synthetic Biology 2022Quote: ... together with an expression vector for the VSV-G envelope protein (pCMV-VSV-G, Addgene plasmid no. 8454), an expression vector for GAG-Pol-Rev (psPAX2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... then 5μg of desired lentiviral vector was co-transfected with 2.5μg of envelope protein vector pMD2.G (Addgene:12258), and 2.5μg of the packaging vector psPAX2 (Addgene ...
-
bioRxiv - Neuroscience 2021Quote: ... expressing the genetically encoded calcium indicator GCaMP6f under control of the calcium/calmodulin-dependent protein kinase (CaMKII) promoter (pENN.AAV5.CAMKII.GCaMP6f.WPRE.SV40, Addgene, Watertown, MA) to drive expression preferentially in principal neurons ...
-
bioRxiv - Cell Biology 2021Quote: ... Of the following vectors the fluorescent protein was exchanged for Tq-Ca-FLITS: 3xnls-mTurquoise2 (Addgene plasmid #98817) for a nuclear tag ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid encoding TDP-43-MBP-His6 for bacterial protein expression was a gift from Nicolas Fawzi (Addgene plasmid #104480 ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid encoding TDP-43-MBP-His6 for bacterial protein expression was a gift from Nicolas Fawzi (Addgene plasmid #104480; http://n2t.net/addgene:104480; RRID:Addgene_104480) (38) ...
-
bioRxiv - Neuroscience 2022Quote: ... 238 μg rep-cap plasmid encoding AAV5 capsid proteins (pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ...
-
bioRxiv - Neuroscience 2022Quote: ... 238 μg rep-cap plasmid encoding AAV5 capsid proteins (pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ; http://n2t.net/addgene:104964 ; RRID:Addgene_104964) and 64.6 μg of either the CalEx plasmid (pZac2.1-GfaABC1D-HA-hPMCA2w/b ...
-
bioRxiv - Cell Biology 2019Quote: ... replacing the mCherry coding sequence in pFA6a-mCherry:Hph with the coding sequence for the photo-switchable fluorescent protein mEOS3.2 (5) (Addgene) by standard restriction-digestion cloning (using restriction enzymes BamHI and AscI ...
-
bioRxiv - Immunology 2020Quote: ... pGBW-m4134096 encoding for SARS-CoV-2 M protein was a gift from Ginkgo Bioworks (Addgene plasmid #152039).
-
bioRxiv - Molecular Biology 2022Quote: ... Plasmid pcDNA3-YFP (for YFP protein) was a gift from Doug Golenbock (Addgene plasmid #13033; http://n2t.net/addgene:13033; RRID:Addgene_13033). Plasmid pcDNA3-YFP-APE1 (for WT YFP-APE1 protein ...
-
bioRxiv - Microbiology 2022Quote: ... The lentiviral vector plasmid pSICO-CPSF6-mNeonGreen encoding CPSF6 fluorescent fusion protein was a gift from Zandrea Ambrose (Addgene plasmid # 167585 ; http://n2t.net/addgene:167585 ; RRID:Addgene_167585).
-
bioRxiv - Cell Biology 2022Quote: ... promoter and upstream of a P2A linker followed by the tdTomato fluorescent protein (gift from Kazuhiro Oka;Addgene plasmid #72486; http://n2t.net/addgene:72486;RRID:Addgene_72486). To obtain a >98% transduced population ...
-
bioRxiv - Neuroscience 2023Quote: ... were used for the fusion protein and then inserted in rAAA-FLEX-axonGCaMP6s-P2A-mRUBY3 vector (#112008, Addgene) used as a backbone after excising axonGCaMP6s by BamHΙ and NheΙ ...
-
bioRxiv - Cancer Biology 2024Quote: Plasmids for expression of lipid anchored fluorescent proteins were obtained from the Addgene repository: MyrPalm-CFP (Addgene #14867) and MyrPalm-GFP (#21037) ...
-
bioRxiv - Physiology 2022Quote: ... promoter and upstream of a P2A linker followed by the tdTomato fluorescent protein (gift from Kazuhiro Oka;Addgene plasmid # 72486; http://n2t.net/addgene:72486; RRID:Addgene_72486). To obtain a >98% transduced population ...
-
bioRxiv - Developmental Biology 2024Quote: ... or pCAG-DeAct-SpvB (a fusion protein of DeAct-SpvB with EGFP, subcloned into pCAG from Addgene #89446) plasmids to 3.5 µg/µL in molecular grade ddH2O with 5% sucrose and 0.1% Fast Green FCF ...
-
bioRxiv - Developmental Biology 2023Quote: ... The protein coding sequence of Lck-GFP was amplified from the Lck-GFP plasmid (Catalog no.61099, Addgene) using Phusion high fidelity polymerase (Catalog no ...
-
bioRxiv - Cell Biology 2023Quote: ... together with an expression vector for the VSV-G envelope protein (pCMV-VSV-G, Addgene plasmid no. 8454), an expression vector for GAG-Pol-Rev (psPAX2 ...
-
bioRxiv - Biochemistry 2023Quote: ... as described in Janecek et al.39 Aurora B protein was expressed from plasmid pNIC28-AurB (Addgene 39119).
-
bioRxiv - Cell Biology 2024Quote: ... For G3BP1 live imaging a GFP-G3BP1 fusion protein containing plasmid (pEGFP-C1-G3BP1-WT, Addgene plasmid # 135997) was transfected with Lipofectamine™ 3000 Transfection Reagent (Invitrogen) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The SNAP protein was amplified from the DNA-CARzeta-GFP plasmid (a gift from Ron Vale, Addgene # 89344). The monomeric streptavidin (mSA) ...
-
bioRxiv - Neuroscience 2023Quote: ... expressing the genetically encoded calcium indicator GCaMP6f under control of the calcium/calmodulin-dependent protein kinase (CaMKII) promoter (pENN.AAV5.CAMKII.GCaMP6f.WPRE.SV40, Addgene, Watertown, MA). Virus (0.5 µl ...
-
bioRxiv - Cancer Biology 2023Quote: ... and a recoded human L1 sequence (encoding both ORF1 and ORF2) cloned from the L1-neo-TET plasmid (Addgene # 51284; a gift from Astrid Roy-Engel)(PubMed 19390602) ...
-
bioRxiv - Immunology 2023Quote: ... Variable regions were cloned into pVITRO1 plasmids that already contained the constant regions for human IgG1 heavy and light chains (κ or λ, Addgene plasmids #61883 and #50366)85 using Gibson Assembly75 ...
-
bioRxiv - Cell Biology 2020Quote: ... and WD repeat domain phosphoinositide-interacting protein 1 (WIPI1) cDNA was a gift from Noboru Mizushima (Addgene plasmid # 38272) (Itakura & Mizushima ...
-
bioRxiv - Immunology 2022Quote: ... To subclone the fusion protein constructs GFPNKG2D-S/L into the retroviral stem cell vector pMIGR1 (Addgene, plasmid 27490), forward 5’ TAGTAGGAATTCGCCACCATGAGCGGGGGCGAGGAC 3’ and the reverse 5’ TAGAGGTCGACCTTACACCGCCCTTTTCATGCAG3’ primers were used ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmids for expression of zinc finger fusion-proteins were newly generated based on the following cDNAs: pMT2 CaVβ1b GFP (gift from Annette Dolphin obtained through Addgene, plasmid # 89893 ...