Labshake search
Citations for Addgene :
1201 - 1250 of 2065 citations for Recombinant HIV 1 GP120 Protein His Avi tagged Biotinylated since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 WT (gift from James Bamburg; Addgene 50859), pEGFP-N1 human cofilin-1 S3E (gift from James Bamburg ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 S3A (gift from James Bamburg; Addgene 50860) cofilin-1 (Garvalov et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... AICSDP-1:PXN-EGFP (Addgene plasmid #87420; http://n2t.net/addgene:87420; RRID:Addgene_87420), AICSDP-10:LMNB1-mEGFP (Addgene plasmid #87422 ...
-
bioRxiv - Genetics 2023Quote: ... 2.5 μg of DNA (1 μg of mCherry-expressing plasmid (Addgene, 72264), and 1.5 μg of either pcDNA4/TO-eGFP ...
-
bioRxiv - Genomics 2023Quote: ... were each cloned into pLKO.1 puro lentiviral vectors (Addgene cat. #8453). Lentiviral particles containing each of the shRNA constructs were generated by calcium phosphate co-transfection of HEK 293T cells with the shRNA pLKO.1 puro vectors and separate pMDLg/pRRE packaging and pCMV-VSV-G envelope plasmids generously provided by Dr ...
-
bioRxiv - Cancer Biology 2023Quote: ... specific shRNAs were cloned into the pLKO.1 TRC plasmid (Addgene #10878), where the puromycin resistance cassette was replaced by the cDNA coding for DsRed-Express2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... specific shRNAs were cloned into the pLKO.1 TRC plasmid (Addgene #10878), where the puromycin resistance cassette was replaced by the cDNA coding for DsRed-Express2 ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 μg of each plasmid pCXLE-hOCT3/4-shp53-F (Addgene #27077), pCXLE-hSK (Addgene #27078) ...
-
bioRxiv - Cell Biology 2023Quote: ... Annealed oligonucleotides were inserted into the pLKO.1-Hygro vector (#24150, Addgene) digested with AgeI and EcoRI ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were transfected with pEGFP-C1-Centrin-1 plasmid (Addgene, Plasmid # 72641) using Lipofectamine2000 according to the manufacture’s recommendations ...
-
bioRxiv - Immunology 2024Quote: ... mTagRFP-Membrane-1 was a gift from Michael Davidson (Addgene plasmid # 57992), and we replaced mTagRFP with mApple to construct the mApple-Mem plasmid ...
-
bioRxiv - Neuroscience 2023Quote: ... doublefloxed.hChR2(H134R).EYFP.WPRE-HGHpA (diluted 1:2 with dPBS; Addgene number: 20298) was injected into auditory cortex as described above in ChAT-Cre animals ...
-
bioRxiv - Neuroscience 2024Quote: ... and pAAV-mDlx-GFP-Fishell-1 (a gift from Gordon Fishell, Addgene plasmid # 83900 ...
-
bioRxiv - Neuroscience 2024Quote: AAV serotype 1 CaMK2a-stGtACR2-FusionRed (1.3 × 1013 gp/mL) (Addgene #105669)83
-
bioRxiv - Cancer Biology 2024Quote: ... shp53 pLKO.1 puro was purchased from Addgene (19119) (shp53 pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 19119 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV9-Syn-Flex-GCaMP6m-WPRE-SV40 (1×10¹³ vg/ml, Addgene 100838).
-
bioRxiv - Neuroscience 2024Quote: ... The following three viruses were utilized: pAAV.1-CAG-GFP (#37825, Addgene), OE-Npbwr1-GFP ...
-
bioRxiv - Neuroscience 2024Quote: ... The following three viruses were employed: pAAV.1-CAG-GFP (#37825, Addgene), OE-Ttr-GFP ...
-
bioRxiv - Cancer Biology 2024Quote: ... specifically the pLenti PGK Blast V5-LUC (w528-1) plasmid (Addgene #19166). The process involved using SalI-HF (New England Biolabs ...
-
bioRxiv - Cell Biology 2024Quote: ... or pCAS9- mCherry-Frame +1 plasmid (for conventional CRISPR-Cas9, Addgene #66940), together with 10 μg PiggyBac transposon system (5 μg transposase + 5 μg hygromycin resistance containing transposon)8 were co-electroporated into human duodenum ...
-
bioRxiv - Cancer Biology 2023Quote: ... expressing Tp53 sgRNA (CCTCGAGCTCCCTCTGAGCC) and the pLKO.1-Hygro (Addgene Plasmid #24150) expressing Nf1 sgRNA (GTTGTGCTCGGTGCTGACTT) ...
-
bioRxiv - Cancer Biology 2024Quote: ... S1 Table) were annealed and cloned into the pLKO.1 vector (RRID:Addgene_8453) (29 ...
-
bioRxiv - Biochemistry 2024Quote: ... and pGEX-6P-1-INTS3-FL were gifts from Yuliang Wu (Addgene plasmids #128307 ...
-
bioRxiv - Biophysics 2024Quote: ... The transfer vector consisted of a modified pLKO.1 neo plasmid (Addgene) with expression of the shRNA sequences under control of 3× copies of the lac operator ...
-
bioRxiv - Cell Biology 2020Quote: ... pLKO.1-shCltc1/ shCltc2/ shCltc3 were individually cotransfected with psPAX2 (ADDGENE NO. 12260), pMD2.G (ADDGENE NO ...
-
bioRxiv - Cell Biology 2020Quote: ... pcDNA3.1-GFP(1-10) was a gift from Bo Huang (Addgene plasmid # 70219). 2PH-PLCdelta-GFP was a gift from Sergio Grinstein (Addgene ...
-
bioRxiv - Developmental Biology 2021Quote: pLKO.1-TSC2 was a gift from Do-Hyung Kim (Addgene plasmid # 15478) and pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 8453) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 8453). Lentivirus was generated as described previously (Ferraiuolo et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... High titer (>1012GC/ml) AAV2/1-hSyn-Cre-WPREhGH virus (Addgene 105553-AAV1) was diluted 1:8 or 1:4 in 0.9% saline and 1µl was injected under the forepaw skin ...
-
bioRxiv - Cell Biology 2022Quote: ... EGFP-Rab1060 was obtained from Addgene (#49472) and pET17b-Kif5b(1-560)-GFP-His61 was obtained from Addgene (#15219).
-
bioRxiv - Biophysics 2021Quote: ... a pRSFDuet-1 plasmid containing His6-SUMO SARS-CoV-2 nsp12 (Addgene #159107) was transformed into E ...
-
bioRxiv - Biophysics 2021Quote: ... the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E ...
-
bioRxiv - Genomics 2020Quote: ... EF06R (5’UTR-LINE-1) was a gift from Eline Luning Prak (Addgene plasmid # 42940 ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV9-CaMKIIα-hChR2(E123A)-EYFP (titer: 1×1013 viral genomes/mL; Addgene: 35505); GAD1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The nontargeting shRNA pLKO.1-blast-SCRAMBLE was obtained from Addgene (Catalog #26701). Two shRNAs for each target were obtained and stable lentiviral transductions with the targeted shRNAs and the scramble control were performed ...
-
bioRxiv - Cell Biology 2021Quote: ... The Lentiviral backbone transfer plasmid p-lentiCRISPR - EGFP sgRNA 1 (Addgene Cat #51760) was used to express human codon-optimized Cas9 protein ...
-
bioRxiv - Cell Biology 2020Quote: ... MEFs were transfected with GFP-swiprosin-1 and GBP-Apex (Addgene plasmid 67651) constructs using a Neon transfection system (as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... or the p53 targeting shRNA (shp53 pLKO.1 puro shRNA (Addgene ID: 19119) (36) ...
-
bioRxiv - Microbiology 2022Quote: THP-1 cells were transduced with lentivirus packaged with pLentiCas9-Blast (Addgene, 52962) generated from HEK293T cells ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV1-hSyn-Cre-WPRE-hGH (Addgene, 10^13 gc/ml, diluted 1:5), AAV5-CAG-FLEX-tdtomato (UNC Viral Core ...
-
bioRxiv - Neuroscience 2022Quote: ... the AAV11 Cap fragment was inserted into pAAV-RC2/1 vector (Addgene, #112862) by T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Biophysics 2022Quote: ... the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E ...
-
bioRxiv - Cell Biology 2021Quote: ... Neo DEST (705-1) (gift from Eric Campeau & Paul Kaufman; Addgene plasmid #17392); pMDLg/pRRE (gift from Didier Trono ...
-
bioRxiv - Developmental Biology 2020Quote: ... Guide RNA (supplementary table 1) were cloned into pCFD3-dU6:3gRNA (Addgene 49410) digested by BbsI using annealed oligonucleotides ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV1-hSyn-hChR2-eYFP (UPenn Vector Core AV-1-26973P / Addgene 26973-AAV1) or AAV1-CamKIIa-hChR2-mCherry (UPenn Vector Core AV-1-26975 / Addgene 26975-AAV1 ...
-
bioRxiv - Neuroscience 2021Quote: ... or control virus (AAV8-hsyn-DIO-mCherry) (1×1013 VG/ml; Addgene, 50459) into 3 NBM/SI sites (350 nl/site ...
-
bioRxiv - Biochemistry 2020Quote: pHA#843: hrp-1p∷hrp-1HsLCΔLC∷hrp-1 3’UTR (Addgene ID: 139200)
-
bioRxiv - Biochemistry 2020Quote: pHA#849: mec-4p∷hrp-1HsLCD290VmScarlet∷hrp-1 3’UTR (Addgene ID: 139203)
-
bioRxiv - Biochemistry 2020Quote: pHA#841: hrp-1p∷hrp-1HsLCWT∷hrp-1 3’UTR (Addgene ID: 139198)
-
bioRxiv - Biochemistry 2020Quote: pHA#848: mec-4p∷hrp-1HsLCWTmScarlet∷hrp-1 3’UTR (Addgene ID: 139202)