Labshake search
Citations for Addgene :
1201 - 1250 of 2074 citations for Acetamide N 5 bis 2 hydroxyethyl amino 2 2 chloro 4 6 dinitrophenyl azo 4 methoxyphenyl since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The LMP1 coding region was amplified from MSCV-N LMP1131 (Addgene plasmid #37962) and cloned into pRetroX-IRES-ZsGreen via Gibson Assembly ...
-
bioRxiv - Biochemistry 2024Quote: USP2 with an N-terminal His-tag was purchased from Addgene (plasmid #36894). AMSH* ...
-
bioRxiv - Biochemistry 2021Quote: ... DNA encoding amino acids Ala696-Phe740 of human DDX1 was cloned into UC Berkeley MacroLab 438C (Addgene plasmid #55220). The resulting plasmid encoded for untagged RTCB(1-505) ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/5: pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and then were inserted into pBP-Gal80Uw-6 (#26236, Addgene) via an L-R reaction with GATEWAY LR clonase II plus enzyme mix (12538120 ...
-
bioRxiv - Developmental Biology 2023Quote: ... EGFP-Tubulin-6 was a gift from Michael Davidson (Addgene plasmid # 56450 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 8 µg sgRNA/Cas9 plasmid (Addgene 62988, Supplementary table 6), 200 µl Opti-Mem (Gibco ...
-
bioRxiv - Molecular Biology 2024Quote: ... 6 μg of the psPAX2 plasmid (Addgene plasmid no. 12260) and 0.6 μg of the pMD2.g plasmid (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... 6 µg of the envelope plasmid pMD2.G (Addgene #12259), and 6 µg the transfer plasmid pLVX-UbC-rtTA-Ngn2:2A:Ascl1 (Addgene #127289 ...
-
bioRxiv - Neuroscience 2021Quote: ... targeted to mouse PGRN exon 1 (oligos with 5’-cacc gGCTCCCTGGGAGGCATCTGG-3’ and 5’-aaac CCAGATGCCTCCCAGGGAGCc-3’ or 5’-cacc gCGGACCCCGACGCAGGTAGG-3’ and 5’-aaac CCTACCTGCGTCGGGGTCCGc-3’ were ligated to pLenti-CRISPRv2 (Addgene)) or Cas9 only ...
-
bioRxiv - Neuroscience 2021Quote: ... and SAD-B19 helper proteins (N, 52.11 mg, Addgene 59924; P, 30.15 mg, Addgene 59925 ...
-
bioRxiv - Molecular Biology 2020Quote: ... pMXs-Hu-N-Myc and pMXs-Hu-L-Myc plasmids were obtained from Addgene. The pCCL-WSB1 and pCCL-c-Myc plasmids were purchased from Genscript ...
-
bioRxiv - Biophysics 2022Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pDEST-CMV-N-mCherry was a gift from Robin Ketteler (Addgene plasmid # 123215) (Agrotis ...
-
bioRxiv - Neuroscience 2021Quote: ... and tTA from pAAV::TM-CaM-NES-TEV-N-AsLOV2-TEVseq-tTA (Addgene #92392) by the conventional PCR reactions ...
-
bioRxiv - Neuroscience 2022Quote: ... Viruses were AAV5-TM-CaM-NES-TEV-N-AsLOV2-TEVseq-tTA (Addgene plasmid #92392), AAV5-M13-TEV-C-P2A-tdTomato (Addgene plasmid #92391) ...
-
bioRxiv - Biochemistry 2021Quote: ... and pGAT2 (N-terminal polyhistidine and GST tags; Addgene #112588; last three genes (61)) by Twist Bioscience ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid # 54920 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pLVU/GFP and pLEX_305-N-dTAG lentiviral plasmid vectors were from Addgene (#24177, #91797). pHTN HaloTag CMV-neo and pHTC HaloTag CMV-neo vectors were from Promega (G7721 ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920 ...
-
bioRxiv - Microbiology 2023Quote: ... coli BL21(DE3) expression strains containing GST-Hsp90 N(9–236) plasmid (Addgene: 22481) were grown in 1 l LB media supplemented with 100 μg/ml ampicillin at 25 °C and shaking (200 r.p.m. ...
-
bioRxiv - Neuroscience 2023Quote: ... rats received infusions of 500 nL of AAV5-hsyn-ChR2-eYFP (n= 22; Addgene 26973 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The plasmid px330- BbsI-PITCh UPF1 N is based on pX330-BbsI-PITCh (Addgene plasmid #127875 ...
-
bioRxiv - Biochemistry 2024Quote: ... The DNA sequence of SLC45A4 was cloned to pLPC-N FLAG vector (Addgene, 12521) using BamHI-HF (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... we performed a Gateway LR reaction with pENTR223_KRASG12V and pLEX305-N-dTAG (Addgene #91797), according to manufacturer’s protocol.
-
bioRxiv - Biochemistry 2024Quote: ... with an N-terminal His-tag was purchased from Addgene (pOPINB-AMSH*, plasmid #66712). SHMT2ΔN(A285T ...
-
bioRxiv - Biochemistry 2020Quote: Recombinant wild-type Streptococcus pyogenes Cas9 REC3 domain (506-712) possessing an amino-terminal His10-MBP tag (Addgene, no. 101205) followed by a TEV protease site was expressed in Escherichia coli strain BL21(DE3 ...
-
bioRxiv - Molecular Biology 2020Quote: Human Drosha cDNA with a Flag-tag at the amino-terminus was cloned into pBABE-puro vector (Addgene plasmid#1764) for producing retrovirus of human Drosha wild type (WT) ...
-
bioRxiv - Microbiology 2021Quote: pLenti.GFP.NLuc is a dual GFP/nanoluciferase lentiviral vector based on pLenti.CMV.GFP.puro that contains a GFP/nanoluciferase cassette separated by a picornavirus P2A self-processing amino acid motif cloned into the BamH-I and Sal-I sites (Addgene plasmid #17448 ...
-
bioRxiv - Cell Biology 2020Quote: ... and FLAG-tagged FL human TSC2 (1807 amino acids, UniProtKB/Swiss-Prot accession number P49815- 1) were purchased from Addgene, and pRK7 was subcloned with FLAG-tagged human TBC1D7 (293 amino acids ...
-
bioRxiv - Biochemistry 2023Quote: The coding sequence for amino acids 1-110 of GCP2 were PCR amplified from pACEBac1-gamma-TuSC (a gift from Tarun Kapoor (Addgene plasmid # 178079 ...
-
bioRxiv - Cancer Biology 2024Quote: Truncated CPSF6 containing amino acids 1-358 (CPSF6-358) from human isoform 1 was cloned into the pCW57.1 backbone (Addgene 71782). A hemagglutinin (HA ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene #104964), pAAV2/6 (Addgene #110660) ...
-
Rhes protein transits from neuron to neuron and facilitates mutant huntingtin spreading in the brainbioRxiv - Neuroscience 2021Quote: ... The mCherry-HTT N171 18Q or 89Q were cloned in 3rd generation Lentiviral vector for bi-cistronic expression of EGFP and the gene of interest (Addgene, 24129) and transfected in HEK 293T cells along with packaging plasmids ...
-
bioRxiv - Immunology 2020Quote: ... antisense: aaacCAGTGATGTCACCCGTGTGC) were hybridised and ligated into the Bsm BI site of pLentiGuide-Puro (gift from Feng Zhang, Addgene # 52963 (20)) ...
-
bioRxiv - Molecular Biology 2023Quote: Constructs for shRNA targeting Primpol (5’- ATTTAGCCGACACCTAATATT) Smarcal1 (5’- CTGATTCAAGAGAAGATTAAA) and Smug1 (5’- AACTATGTGACTCGCTACT) were designed and inserted into pLKO.1neo plasmid (Addgene #13425). Lentiviruses were generated using a standard protocol (Feng and Jasin ...
-
bioRxiv - Cell Biology 2022Quote: ... 6 μg of psPAX2 packaging plasmid (plasmid #12260; Addgene, Teddington, UK), 2 μg pMD2.G envelope plasmid (plasmid #12259 ...
-
bioRxiv - Biophysics 2024Quote: ... and 6 μg of one of the vectors of interest (Addgene #116934 ...
-
bioRxiv - Cell Biology 2024Quote: ... and 6 μg of psPAX2 (Addgene plasmid #12260, from Trono lab). Culture media was changed 12h after transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... The 5-HT1eR and 5-HT1FR PRESTO-Tango constructs were obtained from Addgene. For transfection ...
-
bioRxiv - Microbiology 2022Quote: ... were introduced into a previously described spike-expression plasmid containing D614G and a 21-amino-acid deletion in the cytoplasmic tail (Addgene 158762) (34) ...
-
bioRxiv - Molecular Biology 2020Quote: ... the sequence encoding the native signal peptide and ECD of GPR56 (amino acids 1-400) was subcloned from pCAG-hGPR56-IRES-GFP (from Christopher A Walsh, Addgene 52297) into pCEP4 (Invitrogen ...
-
Targeted attenuation of elevated histone marks at SNCA alleviates α-synuclein in Parkinson’s diseasebioRxiv - Neuroscience 2020Quote: ... The catalytically active domains of JARID1A enzyme (1-797 amino acids) was amplified from pcDNA3/HA-FLAG-RBP2 plasmid (Addgene #14800), a gift from William Kaelin (Klose et al ...
-
bioRxiv - Biochemistry 2022Quote: ... corresponding to amino acids 629-633 of AR) of the eGFP-AR fusion protein73 was removed from peGFP-C1-AR (Addgene #28235) using the Q5 site-directed mutagenesis kit and primer design tools (New England BioLabs ...
-
bioRxiv - Biochemistry 2023Quote: ... The DNA fragment encoding TwCel5CAT was cloned (26 - 320 amino acid residues) into the pNIC-CH expression vector (AddGene, Cambridge, MA), which adds a C-terminal polyhistidine-tag (6xHis-tag ...
-
bioRxiv - Cell Biology 2023Quote: The EGFP-tr53BP1 construct was assembled using Gibson Assembly with a fragment of human 53BP1 (amino acids 1221-1709, Addgene #69531) (4 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The gene sequences encoding the amino-terminal 33 residues of endothelial nitric-oxide synthase as a Golgi targeting sequence (Addgene, 14873) and peroximal targeting signal 1 (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: P4M-GFP and mApple-Talin-N-10 were obtained from Addgene (51469 and 54951 respectively). FAPP-GFP was a gift from Tamas Balla ...
-
bioRxiv - Cell Biology 2020Quote: ... mEmerald-N-Wasp-C-18 and mEmerald-Coronin1B from Michael Davidson (Addgene plasmids #54199, 54050), pmCherry-C1-WIP from Anna Huttenlocher ...
-
bioRxiv - Cancer Biology 2020Quote: ... HPV16 E6 (p6661 MSCV-IP N-HA only 16E6 – Addgene plasmid # 42603 Dr. Peter Howley), HPV16 E7 (p6640 MSCV-P C-FlagHA 16E7-Kozak - Addgene plasmid # 35018 – Dr ...